General Information of Drug Transporter (DT)
DT ID DTD0458 Transporter Info
Gene Name SLC6A6
Transporter Name Sodium- and chloride-dependent taurine transporter
Gene ID
6533
UniProt ID
P31641
Epigenetic Regulations of This DT (EGR)

microRNA

  Multiple system atrophy

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Higher expression of miR-124 in multiple system atrophy [ 1 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC6A6 Experiment Method Immunohistochemical staining

miRNA Stemloop ID

miR-96 miRNA Mature ID Unclear

miRNA Target Type

Direct

Studied Phenotype

Multiple system atrophy[ ICD-11:8D87.0]

Experimental Material

Patient tissue samples

Additional Notes

miR-96 downregulates SLC6A6 in multiple system atrophy, and its dysregulation may play a role in MSA.

  Unclear Phenotype

         27 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-105 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-105 miRNA Mature ID miR-105-5p

miRNA Sequence

UCAAAUGCUCAGACUCCUGUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-134 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-134 miRNA Mature ID miR-134-5p

miRNA Sequence

UGUGACUGGUUGACCAGAGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-151a directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-151a miRNA Mature ID miR-151a-3p

miRNA Sequence

CUAGACUGAAGCUCCUUGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-186 directly targets SLC6A6 [ 3 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-186 miRNA Mature ID miR-186-5p

miRNA Sequence

CAAAGAAUUCUCCUUUUGGGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-23a directly targets SLC6A6 [ 3 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-23a miRNA Mature ID miR-23a-3p

miRNA Sequence

AUCACAUUGCCAGGGAUUUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-27b directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-27b miRNA Mature ID miR-27b-5p

miRNA Sequence

AGAGCUUAGCUGAUUGGUGAAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-3118 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3118 miRNA Mature ID miR-3118

miRNA Sequence

UGUGACUGCAUUAUGAAAAUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-329 directly targets SLC6A6 [ 4 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

AACACACCUGGUUAACCUCUUU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon9

miR-335 directly targets SLC6A6 [ 5 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-362 directly targets SLC6A6 [ 4 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

AACACACCUAUUCAAGGAUUCA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon11

miR-3671 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3671 miRNA Mature ID miR-3671

miRNA Sequence

AUCAAAUAAGGACUAGUCUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-3941 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

UUACACACAACUGAGGAUCAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-423 directly targets SLC6A6 [ 3 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-423 miRNA Mature ID miR-423-5p

miRNA Sequence

UGAGGGGCAGAGAGCGAGACUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

miR-4453 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4453 miRNA Mature ID miR-4453

miRNA Sequence

GAGCUUGGUCUGUAGCGGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-4499 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4499 miRNA Mature ID miR-4499

miRNA Sequence

AAGACUGAGAGGAGGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-4538 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4538 miRNA Mature ID miR-4538

miRNA Sequence

GAGCUUGGAUGAGCUGGGCUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-4789 directly targets SLC6A6 [ 4 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

CACACAUAGCAGGUGUAUAUA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon18

miR-5197 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5197 miRNA Mature ID miR-5197-5p

miRNA Sequence

CAAUGGCACAAACUCAUUCUUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-548as directly targets SLC6A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548as miRNA Mature ID miR-548as-3p

miRNA Sequence

UAAAACCCACAAUUAUGUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

miR-603 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-603 miRNA Mature ID miR-603

miRNA Sequence

CACACACUGCAAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-607 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-607 miRNA Mature ID miR-607

miRNA Sequence

GUUCAAAUCCAGAUCUAUAAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-6079 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6079 miRNA Mature ID miR-6079

miRNA Sequence

UUGGAAGCUUGGACCAACUAGCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-6857 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6857 miRNA Mature ID miR-6857-3p

miRNA Sequence

UGACUGAGCUUCUCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-7853 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7853 miRNA Mature ID miR-7853-5p

miRNA Sequence

UCAAAUGCAGAUCCUGACUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-8485 directly targets SLC6A6 [ 4 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

CACACACACACACACACGUAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon26

miR-943 directly targets SLC6A6 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-943 miRNA Mature ID miR-943

miRNA Sequence

CUGACUGUUGCCGUCCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-96 directly targets SLC6A6 [ 1 ]

Epigenetic Type

microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//qRT-PCR

miRNA Stemloop ID

miR-96 miRNA Mature ID miR-96-5p

miRNA Sequence

UUUGGCACUAGCACAUUUUUGCU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

Methylation

  Atypical teratoid rhabdoid tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC6A6 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.68E-13; Fold-change:0.404310858; Z-score:1.839153423
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Widespread microRNA dysregulation in multiple system atrophy - disease-related alteration in miR-96. Eur J Neurosci. 2014 Mar;39(6):1026-41.
2 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
3 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
4 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
5 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
6 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.