Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0458 Transporter Info | ||||
Gene Name | SLC6A6 | ||||
Transporter Name | Sodium- and chloride-dependent taurine transporter | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Multiple system atrophy |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Higher expression of miR-124 in multiple system atrophy | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
Related Molecular Changes | Down regulation ofSLC6A6 | Experiment Method | Immunohistochemical staining | ||
miRNA Stemloop ID |
miR-96 | miRNA Mature ID | Unclear | ||
miRNA Target Type |
Direct | ||||
Studied Phenotype |
Multiple system atrophy[ ICD-11:8D87.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
miR-96 downregulates SLC6A6 in multiple system atrophy, and its dysregulation may play a role in MSA. | ||||
Unclear Phenotype |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-105 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-105 | miRNA Mature ID | miR-105-5p | ||
miRNA Sequence |
UCAAAUGCUCAGACUCCUGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-134 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-134 | miRNA Mature ID | miR-134-5p | ||
miRNA Sequence |
UGUGACUGGUUGACCAGAGGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-151a directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-151a | miRNA Mature ID | miR-151a-3p | ||
miRNA Sequence |
CUAGACUGAAGCUCCUUGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-186 directly targets SLC6A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-5p | ||
miRNA Sequence |
CAAAGAAUUCUCCUUUUGGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon5 |
miR-23a directly targets SLC6A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-23a | miRNA Mature ID | miR-23a-3p | ||
miRNA Sequence |
AUCACAUUGCCAGGGAUUUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon6 |
miR-27b directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-27b | miRNA Mature ID | miR-27b-5p | ||
miRNA Sequence |
AGAGCUUAGCUGAUUGGUGAAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon7 |
miR-3118 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3118 | miRNA Mature ID | miR-3118 | ||
miRNA Sequence |
UGUGACUGCAUUAUGAAAAUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-329 directly targets SLC6A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-329 | miRNA Mature ID | miR-329-3p | ||
miRNA Sequence |
AACACACCUGGUUAACCUCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon9 |
miR-335 directly targets SLC6A6 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon10 |
miR-362 directly targets SLC6A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-362 | miRNA Mature ID | miR-362-3p | ||
miRNA Sequence |
AACACACCUAUUCAAGGAUUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon11 |
miR-3671 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3671 | miRNA Mature ID | miR-3671 | ||
miRNA Sequence |
AUCAAAUAAGGACUAGUCUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon12 |
miR-3941 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3941 | miRNA Mature ID | miR-3941 | ||
miRNA Sequence |
UUACACACAACUGAGGAUCAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon13 |
miR-423 directly targets SLC6A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-423 | miRNA Mature ID | miR-423-5p | ||
miRNA Sequence |
UGAGGGGCAGAGAGCGAGACUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon14 |
miR-4453 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4453 | miRNA Mature ID | miR-4453 | ||
miRNA Sequence |
GAGCUUGGUCUGUAGCGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon15 |
miR-4499 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4499 | miRNA Mature ID | miR-4499 | ||
miRNA Sequence |
AAGACUGAGAGGAGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon16 |
miR-4538 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4538 | miRNA Mature ID | miR-4538 | ||
miRNA Sequence |
GAGCUUGGAUGAGCUGGGCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon17 |
miR-4789 directly targets SLC6A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4789 | miRNA Mature ID | miR-4789-3p | ||
miRNA Sequence |
CACACAUAGCAGGUGUAUAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon18 |
miR-5197 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5197 | miRNA Mature ID | miR-5197-5p | ||
miRNA Sequence |
CAAUGGCACAAACUCAUUCUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon19 |
miR-548as directly targets SLC6A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548as | miRNA Mature ID | miR-548as-3p | ||
miRNA Sequence |
UAAAACCCACAAUUAUGUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon20 |
miR-603 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-603 | miRNA Mature ID | miR-603 | ||
miRNA Sequence |
CACACACUGCAAUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon21 |
miR-607 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-607 | miRNA Mature ID | miR-607 | ||
miRNA Sequence |
GUUCAAAUCCAGAUCUAUAAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon22 |
miR-6079 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6079 | miRNA Mature ID | miR-6079 | ||
miRNA Sequence |
UUGGAAGCUUGGACCAACUAGCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon23 |
miR-6857 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6857 | miRNA Mature ID | miR-6857-3p | ||
miRNA Sequence |
UGACUGAGCUUCUCCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon24 |
miR-7853 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7853 | miRNA Mature ID | miR-7853-5p | ||
miRNA Sequence |
UCAAAUGCAGAUCCUGACUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon25 |
miR-8485 directly targets SLC6A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
miRNA Sequence |
CACACACACACACACACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon26 |
miR-943 directly targets SLC6A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-943 | miRNA Mature ID | miR-943 | ||
miRNA Sequence |
CUGACUGUUGCCGUCCUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon27 |
miR-96 directly targets SLC6A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Immunohistochemistry//Luciferase reporter assay//qRT-PCR | ||
miRNA Stemloop ID |
miR-96 | miRNA Mature ID | miR-96-5p | ||
miRNA Sequence |
UUUGGCACUAGCACAUUUUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Methylation |
|||||
Atypical teratoid rhabdoid tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC6A6 in atypical teratoid rhabdoid tumour than that in healthy individual | ||||
Studied Phenotype |
Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:4.68E-13; Fold-change:0.404310858; Z-score:1.839153423 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.