Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0456 Transporter Info
Gene Name	SLC6A4
Transporter Name	Sodium-dependent serotonin transporter
Gene ID	6532
UniProt ID	P31645

Epigenetic Regulations of This DT (EGR)
Methylation
Gestational diabetes	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypomethylation of SLC6A4 in gestational diabetes			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	Up regulation ofSLC6A4	Experiment Method	RT-qPCR
Studied Phenotype	Gestational diabetes[ ICD-11:JA63.2]
Experimental Material	Patient tissue samples
Additional Notes	Placental SLC6A4 mRNA levels were inversely correlated with average DNA methylation (p = 0.010) while no statistically significant association was found with the SLC6A4 genotypes (p>0.05).
Adiposity	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypomethylation of SLC6A4 in adiposity			[ 2 ]
Location	CpG5
Epigenetic Type	Methylation	Experiment Method	Bisulfite pyrosequencing
Related Molecular Changes	Down regulation ofSLC6A4	Experiment Method	RT-qPCR
Studied Phenotype	Adiposity[ ICD-11:5B80-5B81]
Experimental Material	Patient tissue samples
Additional Notes	Methylation of both SLC6A4 CpG5 and expression of SLC6A4 was lower in obese compared with lean adults.
Atypical teratoid rhabdoid tumor	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg01330016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:9.61E-09; Z-score:1.46E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	4.76E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg03363743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:1.73E-08; Z-score:-1.68E+00
Methylation in Case	7.97E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg05951817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:5.13E-08; Z-score:-1.22E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A4 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg22584138)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:6.27E-06; Z-score:-1.30E+00
Methylation in Case	4.71E-01 (Median)	Methylation in Control	6.32E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A4 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	5'UTR (cg26126367)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.14E-05; Z-score:-6.64E-01
Methylation in Case	7.49E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A4 in atypical teratoid rhabdoid tumor			[ 3 ]
Location	3'UTR (cg20592995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:4.21E-10; Z-score:1.52E+00
Methylation in Case	7.96E-01 (Median)	Methylation in Control	6.22E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in bladder cancer			[ 4 ]
Location	5'UTR (cg03363743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.90E+00	Statistic Test	p-value:2.18E-06; Z-score:7.26E+00
Methylation in Case	4.02E-01 (Median)	Methylation in Control	2.12E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in bladder cancer			[ 4 ]
Location	5'UTR (cg05951817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.38E+00	Statistic Test	p-value:1.78E-02; Z-score:-2.44E+00
Methylation in Case	2.97E-01 (Median)	Methylation in Control	4.09E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in bladder cancer			[ 4 ]
Location	5'UTR (cg22584138)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.51E+00	Statistic Test	p-value:2.42E-02; Z-score:-2.42E+00
Methylation in Case	2.19E-01 (Median)	Methylation in Control	3.30E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A4 in bladder cancer			[ 4 ]
Location	5'UTR (cg01330016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.84E-02; Z-score:3.09E+00
Methylation in Case	7.34E-01 (Median)	Methylation in Control	6.83E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A4 in bladder cancer			[ 4 ]
Location	TSS1500 (cg18584905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:1.05E-03; Z-score:-3.75E+00
Methylation in Case	1.00E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A4 in bladder cancer			[ 4 ]
Location	TSS200 (cg25725890)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:8.32E-03; Z-score:-2.39E+00
Methylation in Case	6.34E-02 (Median)	Methylation in Control	8.65E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A4 in bladder cancer			[ 4 ]
Location	Body (cg24984698)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.51E+00	Statistic Test	p-value:6.03E-10; Z-score:-1.14E+01
Methylation in Case	4.92E-01 (Median)	Methylation in Control	7.44E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in breast cancer			[ 5 ]
Location	5'UTR (cg03363743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.50E+00	Statistic Test	p-value:3.88E-14; Z-score:1.99E+00
Methylation in Case	4.04E-01 (Median)	Methylation in Control	2.69E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in breast cancer			[ 5 ]
Location	5'UTR (cg26126367)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:5.81E-07; Z-score:-1.64E+00
Methylation in Case	7.75E-01 (Median)	Methylation in Control	8.19E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in breast cancer			[ 5 ]
Location	5'UTR (cg05951817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.48E-02; Z-score:-4.58E-01
Methylation in Case	6.46E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A4 in breast cancer			[ 5 ]
Location	TSS1500 (cg18584905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.39E+00	Statistic Test	p-value:3.04E-09; Z-score:2.45E+00
Methylation in Case	1.48E-01 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A4 in breast cancer			[ 5 ]
Location	TSS1500 (cg06841846)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.43E+00	Statistic Test	p-value:4.34E-04; Z-score:8.11E-01
Methylation in Case	7.30E-02 (Median)	Methylation in Control	5.09E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A4 in breast cancer			[ 5 ]
Location	TSS1500 (cg12074493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.21E-03; Z-score:3.52E-01
Methylation in Case	5.68E-02 (Median)	Methylation in Control	4.88E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A4 in breast cancer			[ 5 ]
Location	TSS200 (cg26741280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:4.21E-02; Z-score:2.25E-01
Methylation in Case	1.77E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC6A4 in breast cancer			[ 5 ]
Location	Body (cg24984698)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:2.59E-06; Z-score:-1.29E+00
Methylation in Case	6.55E-01 (Median)	Methylation in Control	7.06E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	5'UTR (cg03363743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.48E+00	Statistic Test	p-value:1.46E-09; Z-score:2.68E+00
Methylation in Case	7.07E-01 (Median)	Methylation in Control	4.77E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	5'UTR (cg22584138)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:1.11E-07; Z-score:1.97E+00
Methylation in Case	6.86E-01 (Median)	Methylation in Control	4.92E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	5'UTR (cg05951817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:1.86E-07; Z-score:2.19E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	5.64E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	5'UTR (cg01330016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:1.82E-06; Z-score:-1.18E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg18584905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:7.17E-05; Z-score:9.10E-01
Methylation in Case	2.15E-01 (Median)	Methylation in Control	1.87E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg06841846)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.65E-02; Z-score:5.34E-02
Methylation in Case	5.29E-02 (Median)	Methylation in Control	5.22E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	TSS200 (cg26741280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:1.89E-05; Z-score:1.04E+00
Methylation in Case	1.73E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	TSS200 (cg27569822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:1.58E-04; Z-score:1.03E+00
Methylation in Case	4.38E-02 (Median)	Methylation in Control	3.67E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	TSS200 (cg10901968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:5.13E-04; Z-score:3.43E-01
Methylation in Case	3.68E-02 (Median)	Methylation in Control	3.41E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	TSS200 (cg25725890)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:8.62E-04; Z-score:2.68E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	1.02E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC6A4 in colorectal cancer			[ 6 ]
Location	Body (cg24984698)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.97E-09; Z-score:-3.02E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg26126367)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:6.07E-09; Z-score:-4.26E+00
Methylation in Case	7.21E-01 (Median)	Methylation in Control	8.08E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg01330016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.40E-07; Z-score:-2.02E+00
Methylation in Case	7.65E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg05951817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.45E-02; Z-score:-4.79E-01
Methylation in Case	6.66E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg23331484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:1.59E-13; Z-score:3.59E+00
Methylation in Case	6.35E-01 (Median)	Methylation in Control	4.27E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg18584905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.47E+00	Statistic Test	p-value:8.69E-08; Z-score:3.15E+00
Methylation in Case	2.90E-01 (Median)	Methylation in Control	1.98E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg25725890)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.65E+00	Statistic Test	p-value:3.04E-08; Z-score:3.48E+00
Methylation in Case	1.41E-01 (Median)	Methylation in Control	8.58E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg27569822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.85E+00	Statistic Test	p-value:5.39E-07; Z-score:2.09E+00
Methylation in Case	8.15E-02 (Median)	Methylation in Control	4.40E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg10901968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:1.15E-05; Z-score:2.88E-01
Methylation in Case	4.14E-02 (Median)	Methylation in Control	3.71E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg26741280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:2.76E-05; Z-score:3.92E-01
Methylation in Case	1.63E-01 (Median)	Methylation in Control	1.50E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg18016139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.91E+00	Statistic Test	p-value:3.59E-20; Z-score:-4.90E+00
Methylation in Case	4.18E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg23516560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.65E+00	Statistic Test	p-value:6.10E-17; Z-score:-5.34E+00
Methylation in Case	4.48E-01 (Median)	Methylation in Control	7.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg16237262)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:1.13E-14; Z-score:-2.36E+00
Methylation in Case	5.28E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg21136182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:1.39E-13; Z-score:-6.81E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	8.53E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg20669572)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:2.36E-13; Z-score:2.35E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	6.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg04661001)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:3.40E-13; Z-score:2.00E+00
Methylation in Case	8.01E-01 (Median)	Methylation in Control	7.14E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg07479786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.41E-09; Z-score:2.26E+00
Methylation in Case	8.26E-01 (Median)	Methylation in Control	7.54E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC6A4 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg20592995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.12E-04; Z-score:-7.46E-01
Methylation in Case	7.93E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	5'UTR (cg05951817)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:2.17E-03; Z-score:-8.77E-01
Methylation in Case	7.25E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	5'UTR (cg01330016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.51E-02; Z-score:6.21E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	TSS1500 (cg18584905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:8.22E-06; Z-score:2.00E+00
Methylation in Case	1.99E-01 (Median)	Methylation in Control	1.45E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	TSS200 (cg25725890)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:5.51E-05; Z-score:1.19E+00
Methylation in Case	9.44E-02 (Median)	Methylation in Control	7.72E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	TSS200 (cg27569822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.47E+00	Statistic Test	p-value:4.33E-03; Z-score:1.54E+00
Methylation in Case	4.52E-02 (Median)	Methylation in Control	3.08E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	TSS200 (cg10901968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:1.21E-02; Z-score:1.17E+00
Methylation in Case	4.32E-02 (Median)	Methylation in Control	3.36E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	TSS200 (cg26741280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:2.82E-02; Z-score:4.35E-01
Methylation in Case	2.15E-01 (Median)	Methylation in Control	2.07E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	Body (cg24984698)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:6.20E-04; Z-score:-1.03E+00
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC6A4 in HIV infection			[ 8 ]
Location	3'UTR (cg20592995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.96E-05; Z-score:-1.45E+00
Methylation in Case	8.63E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg26126367)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:2.39E-03; Z-score:1.57E+00
Methylation in Case	7.91E-01 (Median)	Methylation in Control	6.92E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg22584138)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:6.27E-03; Z-score:1.96E+00
Methylation in Case	5.52E-01 (Median)	Methylation in Control	4.77E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg03363743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:1.19E-02; Z-score:1.64E+00
Methylation in Case	3.78E-01 (Median)	Methylation in Control	3.11E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A4 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg01330016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:4.92E-02; Z-score:1.03E+00
Methylation in Case	8.04E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A4 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg18584905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:1.65E-02; Z-score:8.13E-01
Methylation in Case	1.94E-01 (Median)	Methylation in Control	1.47E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A4 in lung adenocarcinoma			[ 9 ]
Location	TSS200 (cg27569822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:1.80E-02; Z-score:1.75E+00
Methylation in Case	7.36E-02 (Median)	Methylation in Control	5.50E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A4 in lung adenocarcinoma			[ 9 ]
Location	TSS200 (cg10901968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:1.91E-02; Z-score:1.87E+00
Methylation in Case	5.45E-02 (Median)	Methylation in Control	4.62E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC6A4 in lung adenocarcinoma			[ 9 ]
Location	3'UTR (cg20592995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.69E-02; Z-score:-8.98E-01
Methylation in Case	8.17E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in papillary thyroid cancer			[ 10 ]
Location	5'UTR (cg26126367)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.18E-02; Z-score:-1.39E-01
Methylation in Case	8.95E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in papillary thyroid cancer			[ 10 ]
Location	5'UTR (cg22584138)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:4.36E-02; Z-score:-4.74E-01
Methylation in Case	3.02E-01 (Median)	Methylation in Control	3.26E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in papillary thyroid cancer			[ 10 ]
Location	Body (cg24984698)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.28E-10; Z-score:-1.49E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg19313402)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:3.82E-03; Z-score:-9.26E-01
Methylation in Case	5.91E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS200 (cg19788741)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:4.51E+00	Statistic Test	p-value:3.03E-15; Z-score:2.93E+00
Methylation in Case	2.84E-01 (Median)	Methylation in Control	6.28E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS200 (cg01385367)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.95E-02; Z-score:-3.53E-01
Methylation in Case	4.90E-02 (Median)	Methylation in Control	5.14E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A4 in pancretic ductal adenocarcinoma			[ 11 ]
Location	1stExon (cg23357854)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:1.31E-05; Z-score:-1.35E+00
Methylation in Case	1.35E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A4 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg04764584)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:8.17E-12; Z-score:-2.16E+00
Methylation in Case	3.36E-01 (Median)	Methylation in Control	4.40E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A4 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg13603332)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:8.03E-05; Z-score:-2.68E-01
Methylation in Case	5.00E-01 (Median)	Methylation in Control	5.23E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in prostate cancer			[ 12 ]
Location	TSS1500 (cg02511315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:2.55E-04; Z-score:6.08E+00
Methylation in Case	8.70E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in prostate cancer			[ 12 ]
Location	TSS200 (cg25881850)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.66E+00	Statistic Test	p-value:3.52E-02; Z-score:2.35E+00
Methylation in Case	3.82E-01 (Median)	Methylation in Control	2.30E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A4 in prostate cancer			[ 12 ]
Location	Body (cg02595575)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:4.72E+00	Statistic Test	p-value:1.01E-02; Z-score:5.03E+00
Methylation in Case	4.16E-01 (Median)	Methylation in Control	8.82E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Moderate hypermethylation of SLC6A4 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:3.87E-10; Fold-change:0.209304236; Z-score:4.914445185
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Renal cell carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in clear cell renal cell carcinoma			[ 13 ]
Location	TSS200 (cg27569822)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.46E-02; Z-score:2.90E-01
Methylation in Case	2.48E-02 (Median)	Methylation in Control	2.38E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A4 in clear cell renal cell carcinoma			[ 13 ]
Location	TSS200 (cg26741280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:3.64E-02; Z-score:2.58E-01
Methylation in Case	1.76E-01 (Median)	Methylation in Control	1.69E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in colon adenocarcinoma			[ 14 ]
Location	Body (cg02208504)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:2.17E-03; Z-score:-2.65E+00
Methylation in Case	6.37E-01 (Median)	Methylation in Control	7.21E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A4 in systemic lupus erythematosus			[ 15 ]
Location	Body (cg24984698)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.31E-02; Z-score:-1.59E-01
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypomethylation of SLC6A4 in depressive disorder			[ 19 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Additional Notes	DNA methylation level at the SLC6A4 promoter in the motherchild group, concordant with the depression diagnosis.
Acute myeloid leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC6A4 in acute myeloid leukemia than that in healthy individual
Studied Phenotype	Acute myeloid leukemia [ICD-11:2A60]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.89E-07; Fold-change:0.210558189; Z-score:1.582647806
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC6A4 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:4.71E-35; Fold-change:0.304047268; Z-score:3.747691008
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Histone acetylation
Colorectal cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypoacetylation of SLC6A4 in epithelial colorectal adenocarcinoma (compare with butyrate-treatment counterpart cells)			[ 16 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC6A4	Experiment Method	Western Blot
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Human epithelial colorectal adenocarcinoma cells (Caco-2)
Additional Notes	The SLC6A4 promoter 1 region appears to be specifically modulated by alterations in the acetylation (but not methylation) status of histone H3.
Epigenetic Phenomenon2	Hypoacetylation of SLC6A4 in epithelial colorectal adenocarcinoma (compare with butyrate-treatment counterpart cells)			[ 16 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC6A4	Experiment Method	Western Blot
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Human epithelial colorectal adenocarcinoma cells (Caco-2)
Additional Notes	The SLC6A4 promoter 1 region appears to be specifically modulated by alterations in the acetylation (but not methylation) status of histone H4.
Several types of cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypoacetylation of SLC6A4 in several types of cancer (compare with trichostatin A treatment counterpart cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC6A4	Experiment Method	Western Blot
Studied Phenotype	Several types of cancer[ ICD-11:2A00-2F9Z]
Experimental Material	Multiple cell lines of human
Additional Notes	SLC6A4 gene is epigenetically downregulated by HDAC1 in several types of cancer.
Neuroblastoma cells	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypoacetylation of SLC6A4 in neuroblastoma cells (compare with TSA-treatment counterpart cells)			[ 18 ]
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC6A4	Experiment Method	Western Blot
Studied Phenotype	Neuroblastoma cells
Experimental Material	Human neuroblastoma cell line (SK-NF-I)
Additional Notes	Dramatic upregulation of dopamine and serotonin transporter expression by inhibition of histone deacetylases.
microRNA
Unclear Phenotype	68 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-106a directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106a	miRNA Mature ID	miR-106a-5p
miRNA Sequence	AAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-106b directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106b	miRNA Mature ID	miR-106b-5p
miRNA Sequence	UAAAGUGCUGACAGUGCAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-1184 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1184	miRNA Mature ID	miR-1184
miRNA Sequence	CCUGCAGCGACUUGAUGGCUUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-1205 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1205	miRNA Mature ID	miR-1205
miRNA Sequence	UCUGCAGGGUUUGCUUUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-1237 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1237	miRNA Mature ID	miR-1237-3p
miRNA Sequence	UCCUUCUGCUCCGUCCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-1264 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1264	miRNA Mature ID	miR-1264
miRNA Sequence	CAAGUCUUAUUUGAGCACCUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-1343 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1343	miRNA Mature ID	miR-1343-5p
miRNA Sequence	UGGGGAGCGGCCCCCGGGUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-141 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-141	miRNA Mature ID	miR-141-5p
miRNA Sequence	CAUCUUCCAGUACAGUGUUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-142 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-142	miRNA Mature ID	miR-142-5p
miRNA Sequence	CAUAAAGUAGAAAGCACUACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-150 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-150	miRNA Mature ID	miR-150-5p
miRNA Sequence	UCUCCCAACCCUUGUACCAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-17 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-17	miRNA Mature ID	miR-17-3p
miRNA Sequence	ACUGCAGUGAAGGCACUUGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-17 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-17	miRNA Mature ID	miR-17-5p
miRNA Sequence	CAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-186 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-3p
miRNA Sequence	GCCCAAAGGUGAAUUUUUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-20a directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20a	miRNA Mature ID	miR-20a-5p
miRNA Sequence	UAAAGUGCUUAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-20b directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20b	miRNA Mature ID	miR-20b-5p
miRNA Sequence	CAAAGUGCUCAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-2467 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2467	miRNA Mature ID	miR-2467-3p
miRNA Sequence	AGCAGAGGCAGAGAGGCUCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-302a directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302a	miRNA Mature ID	miR-302a-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUUGGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-302b directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302b	miRNA Mature ID	miR-302b-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUUAGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-302c directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302c	miRNA Mature ID	miR-302c-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUCAGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-302d directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302d	miRNA Mature ID	miR-302d-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-302e directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302e	miRNA Mature ID	miR-302e
miRNA Sequence	UAAGUGCUUCCAUGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-3130 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3130	miRNA Mature ID	miR-3130-3p
miRNA Sequence	GCUGCACCGGAGACUGGGUAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-3158 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3158	miRNA Mature ID	miR-3158-5p
miRNA Sequence	CCUGCAGAGAGGAAGCCCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-3175 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3175	miRNA Mature ID	miR-3175
miRNA Sequence	CGGGGAGAGAACGCAGUGACGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-335 directly targets SLC6A4			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-3678 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3678	miRNA Mature ID	miR-3678-3p
miRNA Sequence	CUGCAGAGUUUGUACGGACCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-372 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-372	miRNA Mature ID	miR-372-3p
miRNA Sequence	AAAGUGCUGCGACAUUUGAGCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-373 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-373	miRNA Mature ID	miR-373-3p
miRNA Sequence	GAAGUGCUUCGAUUUUGGGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-3934 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3934	miRNA Mature ID	miR-3934-5p
miRNA Sequence	UCAGGUGUGGAAACUGAGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-4287 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4287	miRNA Mature ID	miR-4287
miRNA Sequence	UCUCCCUUGAGGGCACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-4418 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4418	miRNA Mature ID	miR-4418
miRNA Sequence	CACUGCAGGACUCAGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-4685 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4685	miRNA Mature ID	miR-4685-3p
miRNA Sequence	UCUCCCUUCCUGCCCUGGCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-4691 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4691	miRNA Mature ID	miR-4691-5p
miRNA Sequence	GUCCUCCAGGCCAUGAGCUGCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-4731 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4731	miRNA Mature ID	miR-4731-5p
miRNA Sequence	UGCUGGGGGCCACAUGAGUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-491 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-491	miRNA Mature ID	miR-491-5p
miRNA Sequence	AGUGGGGAACCCUUCCAUGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon36	miR-5088 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5088	miRNA Mature ID	miR-5088-3p
miRNA Sequence	UCCCUUCUUCCUGGGCCCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-5089 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5089	miRNA Mature ID	miR-5089-5p
miRNA Sequence	GUGGGAUUUCUGAGUAGCAUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon38	miR-509 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-509	miRNA Mature ID	miR-509-5p
miRNA Sequence	UACUGCAGACAGUGGCAAUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon39	miR-512 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-512	miRNA Mature ID	miR-512-3p
miRNA Sequence	AAGUGCUGUCAUAGCUGAGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-519d directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-3p
miRNA Sequence	CAAAGUGCCUCCCUUUAGAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon41	miR-520a directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520a	miRNA Mature ID	miR-520a-3p
miRNA Sequence	AAAGUGCUUCCCUUUGGACUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-520c directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520c	miRNA Mature ID	miR-520c-3p
miRNA Sequence	AAAGUGCUUCCUUUUAGAGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-520d directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520d	miRNA Mature ID	miR-520d-3p
miRNA Sequence	AAAGUGCUUCUCUUUGGUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon44	miR-520g directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520g	miRNA Mature ID	miR-520g-3p
miRNA Sequence	ACAAAGUGCUUCCCUUUAGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon45	miR-520h directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520h	miRNA Mature ID	miR-520h
miRNA Sequence	ACAAAGUGCUUCCCUUUAGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon46	miR-526b directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-526b	miRNA Mature ID	miR-526b-3p
miRNA Sequence	GAAAGUGCUUCCUUUUAGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon47	miR-544a directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-544a	miRNA Mature ID	miR-544a
miRNA Sequence	AUUCUGCAUUUUUAGCAAGUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon48	miR-552 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-552	miRNA Mature ID	miR-552-3p
miRNA Sequence	AACAGGUGACUGGUUAGACAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon49	miR-5589 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5589	miRNA Mature ID	miR-5589-5p
miRNA Sequence	GGCUGGGUGCUCUUGUGCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon50	miR-5590 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5590	miRNA Mature ID	miR-5590-3p
miRNA Sequence	AAUAAAGUUCAUGUAUGGCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon51	miR-5702 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5702	miRNA Mature ID	miR-5702
miRNA Sequence	UGAGUCAGCAACAUAUCCCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon52	miR-619 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-619	miRNA Mature ID	miR-619-5p
miRNA Sequence	GCUGGGAUUACAGGCAUGAGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon53	miR-6504 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6504	miRNA Mature ID	miR-6504-3p
miRNA Sequence	CAUUACAGCACAGCCAUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon54	miR-6506 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6506	miRNA Mature ID	miR-6506-5p
miRNA Sequence	ACUGGGAUGUCACUGAAUAUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon55	miR-6507 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6507	miRNA Mature ID	miR-6507-3p
miRNA Sequence	CAAAGUCCUUCCUAUUUUUCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon56	miR-6749 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6749	miRNA Mature ID	miR-6749-3p
miRNA Sequence	CUCCUCCCCUGCCUGGCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon57	miR-6756 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6756	miRNA Mature ID	miR-6756-5p
miRNA Sequence	AGGGUGGGGCUGGAGGUGGGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon58	miR-6763 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6763	miRNA Mature ID	miR-6763-5p
miRNA Sequence	CUGGGGAGUGGCUGGGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon59	miR-6766 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6766	miRNA Mature ID	miR-6766-5p
miRNA Sequence	CGGGUGGGAGCAGAUCUUAUUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon60	miR-6792 directly targets SLC6A4			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6792	miRNA Mature ID	miR-6792-3p
miRNA Sequence	CUCCUCCACAGCCCCUGCUCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon61	miR-6825 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6825	miRNA Mature ID	miR-6825-5p
miRNA Sequence	UGGGGAGGUGUGGAGUCAGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon62	miR-6878 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6878	miRNA Mature ID	miR-6878-5p
miRNA Sequence	AGGGAGAAAGCUAGAAGCUGAAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon63	miR-6890 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6890	miRNA Mature ID	miR-6890-3p
miRNA Sequence	CCACUGCCUAUGCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon64	miR-7151 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7151	miRNA Mature ID	miR-7151-3p
miRNA Sequence	CUACAGGCUGGAAUGGGCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon65	miR-7156 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7156	miRNA Mature ID	miR-7156-3p
miRNA Sequence	CUGCAGCCACUUGGGGAACUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon66	miR-93 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-93	miRNA Mature ID	miR-93-5p
miRNA Sequence	CAAAGUGCUGUUCGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon67	miR-937 directly targets SLC6A4			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-937	miRNA Mature ID	miR-937-5p
miRNA Sequence	GUGAGUCAGGGUGGGGCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon68	miR-939 directly targets SLC6A4			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-939	miRNA Mature ID	miR-939-5p
miRNA Sequence	UGGGGAGCUGAGGCUCUGGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4) to gestational diabetes mellitus. PLoS One. 2017 Jun 26;12(6):e0179934.
2	Differential SLC6A4 methylation: a predictive epigenetic marker of adiposity from birth to adulthood. Int J Obes (Lond). 2019 Jan 8.
3	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
4	DNA Methylation Dynamics in Urological Tumors.
5	Genome-wide Scan for Methylation Profiles in Breast Cancer
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
14	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
16	Regulation of intestinal serotonin transporter expression via epigenetic mechanisms: role of HDAC2. Am J Physiol Cell Physiol. 2013 Feb 15;304(4):C334-41.
17	Histone deacetylase HDAC1 downregulates transcription of the serotonin transporter (5-HTT) gene in tumor cells. Biochim Biophys Acta. 2015 Aug;1849(8):909-18.
18	Transcriptional modulation of monoaminergic neurotransmission genes by the histone deacetylase inhibitor trichostatin A in neuroblastoma cells. J Neural Transm (Vienna). 2012 Jan;119(1):17-24.
19	Epigenetic variation at the SLC6A4 gene promoter in mother-child pairs with major depressive disorder. J Affect Disord. 2019 Feb 15;245:716-723.
20	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
21	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
22	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
23	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence