General Information of Drug Transporter (DT)
DT ID DTD0451 Transporter Info
Gene Name SLC6A19
Transporter Name Sodium-dependent neutral amino acid transporter B(0)AT1
Gene ID
340024
UniProt ID
Q695T7
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

         16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

5'UTR (cg20227806)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.28E+00 Statistic Test p-value:1.50E-06; Z-score:3.99E+00

Methylation in Case

4.16E-01 (Median) Methylation in Control 1.82E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg10362591)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.65E+00 Statistic Test p-value:3.89E-07; Z-score:3.20E+00

Methylation in Case

6.34E-01 (Median) Methylation in Control 3.83E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg01078332)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:2.19E-06; Z-score:-2.08E+00

Methylation in Case

3.31E-01 (Median) Methylation in Control 4.73E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg22685409)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:3.61E-05; Z-score:1.41E+00

Methylation in Case

5.22E-01 (Median) Methylation in Control 4.15E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg15786180)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:7.94E-05; Z-score:2.30E+00

Methylation in Case

4.34E-01 (Median) Methylation in Control 2.98E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg23391214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:2.74E-03; Z-score:-1.21E+00

Methylation in Case

2.30E-01 (Median) Methylation in Control 3.09E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg21575465)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.19E-03; Z-score:-1.00E+00

Methylation in Case

6.92E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

TSS200 (cg26001902)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.82E+00 Statistic Test p-value:1.16E-05; Z-score:2.18E+00

Methylation in Case

7.23E-01 (Median) Methylation in Control 3.97E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

Body (cg22708635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.71E-05; Z-score:1.79E+00

Methylation in Case

7.05E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

Body (cg20561863)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:3.65E-05; Z-score:-2.25E+00

Methylation in Case

2.87E-01 (Median) Methylation in Control 4.25E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

Body (cg14009098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:4.45E-05; Z-score:2.58E+00

Methylation in Case

6.05E-01 (Median) Methylation in Control 4.36E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

Body (cg03723715)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:1.48E-04; Z-score:-3.10E+00

Methylation in Case

5.41E-01 (Median) Methylation in Control 6.30E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

Body (cg27249906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.01E-03; Z-score:-1.55E+00

Methylation in Case

9.47E-01 (Median) Methylation in Control 9.63E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

Body (cg02629157)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.48E-03; Z-score:-1.22E+00

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

Body (cg00098175)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.65E-03; Z-score:8.27E-01

Methylation in Case

9.02E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in colon adenocarcinoma [ 1 ]

Location

Body (cg04330389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.77E-03; Z-score:-1.23E+00

Methylation in Case

9.26E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         25 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

5'UTR (cg18673401)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.51E+00 Statistic Test p-value:1.49E-12; Z-score:1.60E+00

Methylation in Case

1.57E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg09696301)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.37E+00 Statistic Test p-value:1.66E-22; Z-score:3.29E+00

Methylation in Case

2.41E-01 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg22901008)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:2.57E-08; Z-score:8.39E-01

Methylation in Case

2.37E-01 (Median) Methylation in Control 1.94E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg03983336)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:9.72E-07; Z-score:1.49E+00

Methylation in Case

7.20E-01 (Median) Methylation in Control 5.42E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg14535884)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:4.21E-06; Z-score:-1.06E+00

Methylation in Case

1.39E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg23502298)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:4.86E-02; Z-score:-7.85E-01

Methylation in Case

3.42E-01 (Median) Methylation in Control 3.91E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg01325409)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:2.07E-10; Z-score:-1.66E+00

Methylation in Case

5.63E-01 (Median) Methylation in Control 6.33E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg12135976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:1.29E-05; Z-score:9.50E-01

Methylation in Case

2.90E-01 (Median) Methylation in Control 2.13E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg12799349)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:2.38E-05; Z-score:-1.24E+00

Methylation in Case

1.26E-01 (Median) Methylation in Control 1.53E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg18153630)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:2.84E-04; Z-score:-1.39E+00

Methylation in Case

1.91E-01 (Median) Methylation in Control 2.59E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg14373018)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:4.58E-04; Z-score:-5.27E-01

Methylation in Case

5.78E-01 (Median) Methylation in Control 6.37E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg03464896)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.67E-02; Z-score:-1.54E-02

Methylation in Case

8.52E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

1stExon (cg26923754)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.16E-09; Z-score:1.77E+00

Methylation in Case

5.89E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.48E-12; Z-score:2.59E+00

Methylation in Case

6.51E-01 (Median) Methylation in Control 5.63E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg12671565)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.26E-12; Z-score:-1.23E+00

Methylation in Case

6.59E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg06483795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:2.20E-10; Z-score:1.96E+00

Methylation in Case

8.23E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg23368787)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:1.07E-08; Z-score:1.81E+00

Methylation in Case

5.24E-01 (Median) Methylation in Control 4.07E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg22120714)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.40E+00 Statistic Test p-value:2.44E-06; Z-score:1.32E+00

Methylation in Case

1.86E-01 (Median) Methylation in Control 7.75E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg08701543)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:3.01E-06; Z-score:1.62E+00

Methylation in Case

7.37E-01 (Median) Methylation in Control 6.57E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg13492826)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:8.32E-04; Z-score:8.75E-01

Methylation in Case

7.17E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:3.71E-03; Z-score:-8.08E-01

Methylation in Case

6.82E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg13849066)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.30E-02; Z-score:-7.29E-03

Methylation in Case

9.46E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg17044311)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.72E-02; Z-score:-3.46E-01

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg26175729)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.16E-02; Z-score:-3.87E-01

Methylation in Case

2.58E-01 (Median) Methylation in Control 2.94E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC6A19 in pancretic ductal adenocarcinoma [ 2 ]

Location

3'UTR (cg24945881)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.46E-04; Z-score:-6.90E-01

Methylation in Case

7.84E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in prostate cancer [ 3 ]

Location

5'UTR (cg09300114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.17E+00 Statistic Test p-value:2.60E-04; Z-score:1.59E+01

Methylation in Case

7.66E-01 (Median) Methylation in Control 2.41E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in prostate cancer [ 3 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.09E+00 Statistic Test p-value:7.42E-04; Z-score:2.21E+01

Methylation in Case

5.96E-01 (Median) Methylation in Control 1.46E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in prostate cancer [ 3 ]

Location

TSS1500 (cg20313963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.56E+00 Statistic Test p-value:1.39E-03; Z-score:4.14E+00

Methylation in Case

8.28E-01 (Median) Methylation in Control 5.31E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in prostate cancer [ 3 ]

Location

TSS1500 (cg24900663)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.92E+00 Statistic Test p-value:9.72E-03; Z-score:-2.63E+00

Methylation in Case

9.95E-02 (Median) Methylation in Control 1.91E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in prostate cancer [ 3 ]

Location

TSS200 (cg20095851)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.92E-02; Z-score:2.35E+00

Methylation in Case

8.30E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in prostate cancer [ 3 ]

Location

Body (cg24866407)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:1.19E-02; Z-score:3.74E+00

Methylation in Case

8.52E-01 (Median) Methylation in Control 6.37E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in prostate cancer [ 3 ]

Location

3'UTR (cg10024478)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:2.20E-02; Z-score:1.85E+00

Methylation in Case

7.29E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Bladder cancer

         48 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS1500 (cg11123744)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.28E+00 Statistic Test p-value:1.77E-10; Z-score:-1.90E+01

Methylation in Case

2.29E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS1500 (cg26711638)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.38E+00 Statistic Test p-value:1.77E-10; Z-score:-9.56E+00

Methylation in Case

2.11E-01 (Median) Methylation in Control 5.03E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS1500 (cg11325573)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:2.05E-09; Z-score:-9.22E+00

Methylation in Case

2.54E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS200 (cg02389859)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.89E+00 Statistic Test p-value:1.33E-11; Z-score:-1.53E+01

Methylation in Case

2.66E-01 (Median) Methylation in Control 5.02E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS200 (cg21487099)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.66E+00 Statistic Test p-value:9.85E-11; Z-score:-8.59E+00

Methylation in Case

3.40E-01 (Median) Methylation in Control 5.65E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS200 (cg04309194)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.68E+00 Statistic Test p-value:1.01E-10; Z-score:-1.07E+01

Methylation in Case

3.82E-01 (Median) Methylation in Control 6.42E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS200 (cg26948274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.63E+00 Statistic Test p-value:7.32E-10; Z-score:-8.75E+00

Methylation in Case

2.86E-01 (Median) Methylation in Control 4.67E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS200 (cg09837037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.74E+00 Statistic Test p-value:2.33E-09; Z-score:-7.46E+00

Methylation in Case

4.21E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

TSS200 (cg21492882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.66E+00 Statistic Test p-value:8.44E-09; Z-score:-7.25E+00

Methylation in Case

3.26E-01 (Median) Methylation in Control 5.41E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg02685680)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.88E+00 Statistic Test p-value:6.08E-17; Z-score:-1.94E+01

Methylation in Case

3.98E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg24114651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.63E+00 Statistic Test p-value:1.41E-13; Z-score:-1.90E+01

Methylation in Case

2.85E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg24041118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.04E+00 Statistic Test p-value:2.24E-13; Z-score:-3.94E+01

Methylation in Case

4.00E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.24E+00 Statistic Test p-value:2.97E-13; Z-score:-1.42E+01

Methylation in Case

3.01E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg09517450)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.03E+00 Statistic Test p-value:1.24E-12; Z-score:-2.16E+01

Methylation in Case

4.46E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg06556827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:2.57E-10; Z-score:-1.66E+01

Methylation in Case

6.34E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg20475114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.57E+00 Statistic Test p-value:1.20E-09; Z-score:-2.08E+01

Methylation in Case

4.22E-01 (Median) Methylation in Control 6.63E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg07010687)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.98E+00 Statistic Test p-value:2.52E-09; Z-score:-1.29E+01

Methylation in Case

4.06E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg00502885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.24E+00 Statistic Test p-value:4.16E-09; Z-score:-1.51E+01

Methylation in Case

3.48E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg05887366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:1.11E-08; Z-score:-1.33E+01

Methylation in Case

4.35E-01 (Median) Methylation in Control 6.66E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg19619756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:2.49E-08; Z-score:-1.00E+01

Methylation in Case

3.58E-01 (Median) Methylation in Control 5.26E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg02580900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:2.13E-07; Z-score:-9.05E+00

Methylation in Case

4.80E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg11666857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.75E+00 Statistic Test p-value:2.41E-07; Z-score:-5.74E+00

Methylation in Case

3.66E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg04135385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:7.40E-07; Z-score:-1.01E+01

Methylation in Case

6.43E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg09648809)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.16E-06; Z-score:-5.87E+00

Methylation in Case

7.96E-01 (Median) Methylation in Control 9.39E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg20706711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.55E+00 Statistic Test p-value:4.79E-06; Z-score:-6.39E+00

Methylation in Case

4.04E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg05005358)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:8.13E-06; Z-score:-4.65E+00

Methylation in Case

5.81E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg23260105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:2.57E-05; Z-score:-8.99E+00

Methylation in Case

7.42E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg26537272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:9.49E-05; Z-score:-1.14E+01

Methylation in Case

8.06E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon29

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg22165524)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:1.13E-04; Z-score:-8.02E+00

Methylation in Case

7.62E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon30

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg23119827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:1.84E-04; Z-score:-4.27E+00

Methylation in Case

5.99E-01 (Median) Methylation in Control 7.00E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon31

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg10800865)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.53E-04; Z-score:-8.88E+00

Methylation in Case

8.17E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon32

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg11842953)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.78E-04; Z-score:-8.23E+00

Methylation in Case

8.33E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon33

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg03807914)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:5.03E-04; Z-score:-4.27E+00

Methylation in Case

7.87E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon34

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg10979994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:6.99E-04; Z-score:-7.11E+00

Methylation in Case

8.04E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon35

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg04553355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.32E-04; Z-score:-2.97E+00

Methylation in Case

8.83E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon36

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg16367697)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.16E-03; Z-score:-6.62E+00

Methylation in Case

7.27E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon37

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg04718185)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:1.45E-03; Z-score:-3.87E+00

Methylation in Case

5.67E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon38

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg15142890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.47E-03; Z-score:-2.52E+00

Methylation in Case

8.76E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon39

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg06048662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.58E-03; Z-score:-2.72E+00

Methylation in Case

9.28E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon40

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg06593603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:1.88E-03; Z-score:-3.80E+00

Methylation in Case

2.96E-01 (Median) Methylation in Control 4.38E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon41

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg22632352)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:3.86E-03; Z-score:-4.78E+00

Methylation in Case

5.45E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon42

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg01840128)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.22E-02; Z-score:-8.18E-01

Methylation in Case

8.81E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon43

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg02327812)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.42E-02; Z-score:-5.71E-03

Methylation in Case

9.33E-01 (Median) Methylation in Control 9.33E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon44

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

Body (cg10035234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:4.35E-02; Z-score:7.31E-02

Methylation in Case

8.52E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon45

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

3'UTR (cg18515046)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:7.77E-05; Z-score:-3.96E+00

Methylation in Case

4.66E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon46

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

3'UTR (cg26197930)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:8.60E-05; Z-score:-3.39E+00

Methylation in Case

8.04E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon47

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

3'UTR (cg04248937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.18E-02; Z-score:-2.69E+00

Methylation in Case

8.44E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon48

Methylation of SLC6A19 in bladder cancer [ 4 ]

Location

3'UTR (cg26498616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.19E-02; Z-score:-1.19E+00

Methylation in Case

8.41E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Depression

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in depression [ 5 ]

Location

TSS1500 (cg11123744)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.52E-02; Z-score:6.90E-01

Methylation in Case

6.69E-01 (Median) Methylation in Control 6.18E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in depression [ 5 ]

Location

TSS200 (cg09837037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:3.46E-02; Z-score:3.73E-01

Methylation in Case

9.47E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in depression [ 5 ]

Location

Body (cg24114651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.21E-02; Z-score:5.17E-01

Methylation in Case

7.93E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         30 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg26711638)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:5.93E-03; Z-score:-7.71E-01

Methylation in Case

4.10E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg26763542)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.63E+00 Statistic Test p-value:2.55E-18; Z-score:-6.55E+00

Methylation in Case

4.31E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg06517798)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:2.36E-14; Z-score:-8.74E+00

Methylation in Case

5.93E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg27056599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.76E+00 Statistic Test p-value:3.89E-12; Z-score:7.14E+00

Methylation in Case

3.32E-01 (Median) Methylation in Control 8.83E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg27619475)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:1.39E-11; Z-score:1.70E+00

Methylation in Case

5.64E-01 (Median) Methylation in Control 4.23E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg26948274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:5.39E-04; Z-score:-1.06E+00

Methylation in Case

4.47E-01 (Median) Methylation in Control 5.17E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg02389859)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:8.51E-04; Z-score:-1.30E+00

Methylation in Case

4.67E-01 (Median) Methylation in Control 5.65E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg24266851)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:7.48E-19; Z-score:-3.01E+00

Methylation in Case

5.27E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg18948221)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:5.36E-14; Z-score:-4.97E+00

Methylation in Case

5.80E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg14502431)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:4.34E-12; Z-score:-8.31E+00

Methylation in Case

7.14E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg16367697)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:2.81E-08; Z-score:-1.26E+00

Methylation in Case

6.53E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg20706711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:3.78E-08; Z-score:-1.76E+00

Methylation in Case

6.23E-01 (Median) Methylation in Control 7.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg22165524)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:3.98E-08; Z-score:-2.03E+00

Methylation in Case

8.05E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:9.08E-08; Z-score:-2.22E+00

Methylation in Case

5.81E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg10035234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.08E-07; Z-score:-2.91E+00

Methylation in Case

8.03E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg22632352)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:5.30E-07; Z-score:-1.32E+00

Methylation in Case

7.64E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg15142890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.12E-06; Z-score:-2.32E+00

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg04553355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.35E-06; Z-score:-1.86E+00

Methylation in Case

8.56E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg05887366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.26E-06; Z-score:-1.11E+00

Methylation in Case

6.63E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg04718185)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:3.89E-06; Z-score:-1.51E+00

Methylation in Case

7.05E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg26537272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.29E-05; Z-score:-8.78E-01

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg12562822)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.11E+00 Statistic Test p-value:1.08E-04; Z-score:-5.45E-01

Methylation in Case

1.35E-01 (Median) Methylation in Control 2.86E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg10800865)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.42E-04; Z-score:-8.47E-01

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg01840128)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.39E-03; Z-score:-3.09E-01

Methylation in Case

8.43E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

Body (cg24041118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:4.49E-02; Z-score:3.56E-01

Methylation in Case

7.54E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg12757078)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:1.98E-12; Z-score:-2.28E+00

Methylation in Case

5.46E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg26498616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.20E-08; Z-score:-2.38E+00

Methylation in Case

8.86E-01 (Median) Methylation in Control 9.50E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg26197930)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.48E-06; Z-score:-5.91E-01

Methylation in Case

8.32E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon29

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg22599115)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.14E-03; Z-score:-5.27E-01

Methylation in Case

9.32E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon30

Methylation of SLC6A19 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg04248937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:7.16E-03; Z-score:-4.35E-01

Methylation in Case

6.32E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

TSS1500 (cg11123744)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.22E-02; Z-score:3.86E-01

Methylation in Case

7.08E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

TSS200 (cg04309194)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:5.84E-03; Z-score:7.18E-01

Methylation in Case

8.56E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg10979994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.64E-05; Z-score:8.03E-01

Methylation in Case

9.14E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg20475114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.92E-04; Z-score:-1.36E+00

Methylation in Case

6.57E-01 (Median) Methylation in Control 7.17E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg03807914)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.13E-04; Z-score:7.89E-01

Methylation in Case

8.84E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg10800865)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.44E-03; Z-score:4.87E-01

Methylation in Case

9.52E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg06048662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.86E-03; Z-score:4.11E-01

Methylation in Case

9.73E-01 (Median) Methylation in Control 9.66E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg24041118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.06E-03; Z-score:-1.12E+00

Methylation in Case

8.32E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg24114651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.19E-03; Z-score:-7.30E-01

Methylation in Case

8.28E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg05972316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:5.91E-03; Z-score:1.03E+00

Methylation in Case

2.21E-01 (Median) Methylation in Control 1.83E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg10035234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:9.79E-03; Z-score:7.51E-01

Methylation in Case

9.32E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg09648809)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.01E-02; Z-score:7.92E-01

Methylation in Case

9.73E-01 (Median) Methylation in Control 9.59E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg06593603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.02E-02; Z-score:-4.75E-01

Methylation in Case

4.32E-01 (Median) Methylation in Control 4.73E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.15E-02; Z-score:-1.03E+00

Methylation in Case

7.29E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in HIV infection [ 7 ]

Location

Body (cg00502885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.74E-02; Z-score:-3.22E-01

Methylation in Case

8.68E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         28 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

TSS1500 (cg26711638)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.17E-02; Z-score:-4.86E-01

Methylation in Case

2.58E-01 (Median) Methylation in Control 2.92E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

TSS1500 (cg11123744)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.31E-02; Z-score:3.03E-01

Methylation in Case

2.77E-01 (Median) Methylation in Control 2.58E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

TSS200 (cg21492882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.57E-03; Z-score:1.04E+00

Methylation in Case

4.94E-01 (Median) Methylation in Control 4.42E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

TSS200 (cg09837037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:4.40E-03; Z-score:1.37E+00

Methylation in Case

7.84E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg07010687)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:8.31E-15; Z-score:-3.15E+00

Methylation in Case

7.65E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg24114651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:9.14E-12; Z-score:-2.73E+00

Methylation in Case

7.58E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg05005358)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.48E-11; Z-score:-2.38E+00

Methylation in Case

8.20E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg06556827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:5.70E-11; Z-score:-3.39E+00

Methylation in Case

8.42E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:7.02E-11; Z-score:-1.90E+00

Methylation in Case

6.71E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg02580900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.07E-09; Z-score:-1.86E+00

Methylation in Case

7.23E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg20475114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.71E-07; Z-score:-1.21E+00

Methylation in Case

7.22E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg03807914)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.86E-06; Z-score:-1.16E+00

Methylation in Case

8.63E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg04135385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.41E-05; Z-score:-1.16E+00

Methylation in Case

8.73E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg04553355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.38E-05; Z-score:-9.40E-01

Methylation in Case

9.43E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg06048662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.41E-04; Z-score:-7.43E-01

Methylation in Case

9.29E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg24041118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:7.38E-04; Z-score:-2.83E-01

Methylation in Case

7.07E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg02685680)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:8.72E-04; Z-score:-5.49E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg10979994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:8.80E-04; Z-score:-6.59E-01

Methylation in Case

8.60E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg09648809)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.27E-03; Z-score:-2.62E-01

Methylation in Case

9.01E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg05887366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.57E-03; Z-score:-4.70E-01

Methylation in Case

7.03E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg23119827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.42E-03; Z-score:-3.86E-01

Methylation in Case

7.56E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg16367697)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:6.41E-03; Z-score:-3.58E-01

Methylation in Case

8.63E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg19619756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:6.87E-03; Z-score:-5.02E-01

Methylation in Case

5.58E-01 (Median) Methylation in Control 5.80E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg23000153)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.26E-02; Z-score:-4.54E-01

Methylation in Case

8.89E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg00502885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.50E-02; Z-score:-2.94E-01

Methylation in Case

7.77E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg15142890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.56E-02; Z-score:-3.35E-01

Methylation in Case

9.39E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

Body (cg10035234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.26E-02; Z-score:-7.59E-01

Methylation in Case

9.12E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC6A19 in papillary thyroid cancer [ 8 ]

Location

3'UTR (cg26197930)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.39E-02; Z-score:-2.24E-01

Methylation in Case

8.99E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Breast cancer

         27 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

TSS200 (cg09837037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.47E-02; Z-score:-1.08E+00

Methylation in Case

6.11E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg20475114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:3.35E-14; Z-score:-2.70E+00

Methylation in Case

5.00E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg23119827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.35E-13; Z-score:2.18E+00

Methylation in Case

7.05E-01 (Median) Methylation in Control 6.33E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg07010687)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:2.08E-11; Z-score:-2.56E+00

Methylation in Case

5.37E-01 (Median) Methylation in Control 6.59E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg05972316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:7.00E-11; Z-score:1.92E+00

Methylation in Case

1.95E-01 (Median) Methylation in Control 1.42E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg05005358)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.62E-07; Z-score:-1.53E+00

Methylation in Case

6.83E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg06593603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:1.94E-06; Z-score:-2.22E+00

Methylation in Case

3.36E-01 (Median) Methylation in Control 4.34E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg19619756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.97E-06; Z-score:-1.28E+00

Methylation in Case

4.73E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg02580900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.12E-06; Z-score:-1.52E+00

Methylation in Case

5.69E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg16367697)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.81E-06; Z-score:-6.16E-01

Methylation in Case

7.13E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg10979994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:4.82E-06; Z-score:-1.36E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg06048662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:8.45E-06; Z-score:-1.36E+00

Methylation in Case

9.13E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg24041118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:1.66E-05; Z-score:-2.01E+00

Methylation in Case

5.56E-01 (Median) Methylation in Control 6.63E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg09648809)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.28E-05; Z-score:-1.35E+00

Methylation in Case

8.17E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg03807914)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.13E-04; Z-score:-1.12E+00

Methylation in Case

7.37E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg04135385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.85E-04; Z-score:-1.11E+00

Methylation in Case

7.52E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg04553355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.97E-04; Z-score:-9.13E-01

Methylation in Case

8.53E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg23260105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.10E-04; Z-score:-7.60E-01

Methylation in Case

8.66E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg02685680)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:4.25E-04; Z-score:-1.40E+00

Methylation in Case

6.29E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg11666857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:6.11E-04; Z-score:-7.92E-01

Methylation in Case

5.65E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.49E-03; Z-score:-1.03E+00

Methylation in Case

5.01E-01 (Median) Methylation in Control 5.40E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg09517450)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:3.27E-03; Z-score:-1.03E+00

Methylation in Case

7.81E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg10035234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:4.61E-03; Z-score:4.84E-01

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg01840128)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.72E-03; Z-score:-1.58E-02

Methylation in Case

8.73E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg04718185)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.11E-02; Z-score:-4.69E-01

Methylation in Case

6.79E-01 (Median) Methylation in Control 6.97E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg25582398)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:3.89E-02; Z-score:-7.94E-01

Methylation in Case

7.63E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC6A19 in breast cancer [ 9 ]

Location

Body (cg11842953)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.49E-02; Z-score:-6.12E-01

Methylation in Case

7.90E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

         19 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

TSS200 (cg02389859)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:1.83E-05; Z-score:-2.83E+00

Methylation in Case

5.31E-01 (Median) Methylation in Control 6.38E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

TSS200 (cg26948274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:6.93E-04; Z-score:-2.02E+00

Methylation in Case

5.24E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

TSS200 (cg21487099)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:3.66E-02; Z-score:-1.37E+00

Methylation in Case

5.98E-01 (Median) Methylation in Control 6.59E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg01840128)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:9.12E-08; Z-score:5.91E+00

Methylation in Case

7.79E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg04553355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.24E-06; Z-score:-1.54E+00

Methylation in Case

9.68E-01 (Median) Methylation in Control 9.76E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg07010687)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.00E-06; Z-score:-3.04E+00

Methylation in Case

8.29E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg04718185)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:3.35E-05; Z-score:3.42E+00

Methylation in Case

8.17E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg23260105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.20E-04; Z-score:2.29E+00

Methylation in Case

9.70E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg06556827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.23E-04; Z-score:-1.04E+00

Methylation in Case

9.27E-01 (Median) Methylation in Control 9.40E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg20706711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:1.57E-04; Z-score:2.89E+00

Methylation in Case

7.71E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg22632352)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.21E-04; Z-score:2.51E+00

Methylation in Case

8.99E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg11666857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:1.30E-02; Z-score:1.95E+00

Methylation in Case

7.39E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg02580900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.71E-02; Z-score:-5.72E-01

Methylation in Case

8.34E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg19619756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.81E-02; Z-score:9.47E-01

Methylation in Case

5.88E-01 (Median) Methylation in Control 5.49E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg10979994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.89E-02; Z-score:-6.80E-01

Methylation in Case

8.91E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg06593603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:1.90E-02; Z-score:1.55E+00

Methylation in Case

4.74E-01 (Median) Methylation in Control 4.00E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg20475114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.13E-02; Z-score:-3.75E-01

Methylation in Case

7.47E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg00502885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.12E-02; Z-score:-4.59E-01

Methylation in Case

9.47E-01 (Median) Methylation in Control 9.52E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A19 in clear cell renal cell carcinoma [ 10 ]

Location

Body (cg06048662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.54E-02; Z-score:-4.52E-01

Methylation in Case

9.74E-01 (Median) Methylation in Control 9.76E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         33 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

TSS200 (cg26948274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:3.20E-02; Z-score:-8.23E-01

Methylation in Case

5.56E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg07010687)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:5.91E-14; Z-score:-6.61E+00

Methylation in Case

7.52E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg20475114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:2.71E-13; Z-score:-4.51E+00

Methylation in Case

7.24E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg24114651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.72E-12; Z-score:-5.76E+00

Methylation in Case

7.87E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg02580900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:5.96E-11; Z-score:-3.70E+00

Methylation in Case

8.01E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg05005358)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.49E-07; Z-score:-2.73E+00

Methylation in Case

8.61E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg23260105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:6.41E-07; Z-score:-3.04E+00

Methylation in Case

9.42E-01 (Median) Methylation in Control 9.74E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg10979994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:8.22E-07; Z-score:-2.79E+00

Methylation in Case

8.88E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg05972316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:1.13E-06; Z-score:1.31E+00

Methylation in Case

2.67E-01 (Median) Methylation in Control 2.23E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg11666857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.65E-06; Z-score:-1.45E+00

Methylation in Case

8.33E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg10800865)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:7.30E-06; Z-score:-3.59E+00

Methylation in Case

9.29E-01 (Median) Methylation in Control 9.52E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg06556827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:9.25E-06; Z-score:-2.17E+00

Methylation in Case

9.05E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg05887366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.18E-05; Z-score:-7.57E-01

Methylation in Case

8.50E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg06048662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.92E-05; Z-score:-1.47E+00

Methylation in Case

9.64E-01 (Median) Methylation in Control 9.73E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg06593603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.58E+00 Statistic Test p-value:3.27E-05; Z-score:-1.15E+00

Methylation in Case

2.93E-01 (Median) Methylation in Control 4.63E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg20706711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:4.57E-05; Z-score:-1.64E+00

Methylation in Case

7.68E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg16367697)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.01E-04; Z-score:-1.62E+00

Methylation in Case

9.14E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg00502885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.88E-04; Z-score:-7.09E-01

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg09648809)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.18E-04; Z-score:-8.92E-01

Methylation in Case

9.45E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg23119827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.42E-03; Z-score:-7.83E-01

Methylation in Case

8.92E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg11842953)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.52E-03; Z-score:-7.01E-01

Methylation in Case

9.33E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg03807914)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.71E-03; Z-score:-5.44E-01

Methylation in Case

9.33E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.70E-03; Z-score:-2.90E-01

Methylation in Case

7.87E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg12562822)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.25E+00 Statistic Test p-value:8.12E-03; Z-score:-6.56E-01

Methylation in Case

9.41E-02 (Median) Methylation in Control 2.11E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg01840128)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.64E-02; Z-score:1.25E+00

Methylation in Case

9.26E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg25582398)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.73E-02; Z-score:-1.37E-01

Methylation in Case

9.35E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg23000153)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.68E-02; Z-score:7.45E-01

Methylation in Case

9.07E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg26537272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.88E-02; Z-score:-3.14E-01

Methylation in Case

9.36E-01 (Median) Methylation in Control 9.39E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon29

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg24041118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:4.24E-02; Z-score:-5.44E-01

Methylation in Case

6.92E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon30

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

Body (cg15142890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.36E-02; Z-score:-1.01E-01

Methylation in Case

9.55E-01 (Median) Methylation in Control 9.55E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon31

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

3'UTR (cg22599115)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.78E-03; Z-score:-5.53E-01

Methylation in Case

9.44E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon32

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

3'UTR (cg04248937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:8.31E-03; Z-score:5.12E-01

Methylation in Case

8.73E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon33

Methylation of SLC6A19 in colorectal cancer [ 11 ]

Location

3'UTR (cg26498616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.40E-02; Z-score:-5.12E-01

Methylation in Case

9.51E-01 (Median) Methylation in Control 9.61E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

TSS200 (cg02389859)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.76E-03; Z-score:-1.95E-01

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

TSS200 (cg26948274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.30E-02; Z-score:-1.04E-01

Methylation in Case

7.40E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg11842953)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.04E-03; Z-score:-2.32E-01

Methylation in Case

9.18E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg02327812)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.26E-03; Z-score:-5.41E-02

Methylation in Case

9.52E-01 (Median) Methylation in Control 9.54E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg02580900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.81E-03; Z-score:-2.04E-01

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg05005358)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.33E-02; Z-score:-1.86E-01

Methylation in Case

8.75E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg02685680)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.62E-02; Z-score:-1.30E-01

Methylation in Case

8.60E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg04553355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:2.34E-02; Z-score:-4.58E-02

Methylation in Case

9.22E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg04718185)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.00E-02; Z-score:-1.72E-01

Methylation in Case

8.82E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg20706711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.24E-02; Z-score:-2.06E-01

Methylation in Case

7.96E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in systemic lupus erythematosus [ 12 ]

Location

Body (cg06593603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.30E-02; Z-score:-1.77E-01

Methylation in Case

2.83E-01 (Median) Methylation in Control 3.09E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

         30 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.67E-05; Z-score:5.63E-01

Methylation in Case

9.68E-02 (Median) Methylation in Control 8.93E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg00502885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:2.75E-05; Z-score:-1.15E+00

Methylation in Case

6.59E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg01840128)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.45E+00 Statistic Test p-value:9.00E-05; Z-score:-1.48E+00

Methylation in Case

2.18E-01 (Median) Methylation in Control 5.35E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg02327812)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.44E-04; Z-score:5.90E-01

Methylation in Case

2.63E-01 (Median) Methylation in Control 2.26E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg02580900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.79E-04; Z-score:1.02E+00

Methylation in Case

8.48E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg02685680)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:2.08E-04; Z-score:5.64E-01

Methylation in Case

8.25E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg03807914)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:4.39E-04; Z-score:1.16E+00

Methylation in Case

8.10E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg04135385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.81E+00 Statistic Test p-value:5.65E-04; Z-score:-3.63E-01

Methylation in Case

4.07E-02 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg04553355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:8.64E-04; Z-score:-6.87E-01

Methylation in Case

7.10E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg04718185)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:9.36E-04; Z-score:-9.30E-01

Methylation in Case

5.47E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg05005358)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.48E+00 Statistic Test p-value:1.17E-03; Z-score:-5.06E-01

Methylation in Case

3.83E-02 (Median) Methylation in Control 9.47E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg05887366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:1.76E-03; Z-score:-7.26E-01

Methylation in Case

4.70E-01 (Median) Methylation in Control 5.63E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg05972316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.97E-03; Z-score:-4.84E-01

Methylation in Case

8.95E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg06048662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.10E-03; Z-score:1.21E+00

Methylation in Case

8.90E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg06556827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.72E+00 Statistic Test p-value:2.54E-03; Z-score:-6.85E-01

Methylation in Case

5.75E-02 (Median) Methylation in Control 9.87E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg06593603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.65E-03; Z-score:-6.41E-01

Methylation in Case

6.39E-01 (Median) Methylation in Control 6.60E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg07010687)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.48E+00 Statistic Test p-value:3.23E-03; Z-score:1.11E+00

Methylation in Case

6.76E-01 (Median) Methylation in Control 4.57E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg09517450)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.09E-02; Z-score:-5.49E-01

Methylation in Case

9.61E-01 (Median) Methylation in Control 9.76E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg09648809)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.15E-02; Z-score:1.18E+00

Methylation in Case

8.24E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg10035234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.35E-02; Z-score:4.26E-01

Methylation in Case

8.09E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg10800865)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:1.82E-02; Z-score:-8.16E-01

Methylation in Case

2.03E-01 (Median) Methylation in Control 2.60E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg10979994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.96E-02; Z-score:-2.59E-01

Methylation in Case

9.59E-01 (Median) Methylation in Control 9.64E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg11666857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.40E-02; Z-score:4.19E-01

Methylation in Case

9.40E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg11842953)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.54E-02; Z-score:-2.72E-01

Methylation in Case

9.17E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

Body (cg12562822)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:2.81E-02; Z-score:-7.14E-01

Methylation in Case

1.58E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

3'UTR (cg04248937)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.44E+00 Statistic Test p-value:2.75E-14; Z-score:-2.26E+00

Methylation in Case

5.19E-01 (Median) Methylation in Control 7.49E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

3'UTR (cg18515046)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:1.67E-10; Z-score:1.74E+00

Methylation in Case

8.33E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

3'UTR (cg22599115)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:6.15E-10; Z-score:-1.89E+00

Methylation in Case

6.35E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon29

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

3'UTR (cg26197930)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:2.73E-09; Z-score:-1.58E+00

Methylation in Case

6.91E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon30

Methylation of SLC6A19 in atypical teratoid rhabdoid tumor [ 13 ]

Location

3'UTR (cg26498616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:2.79E-09; Z-score:-1.48E+00

Methylation in Case

4.79E-01 (Median) Methylation in Control 5.88E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg20706711)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:4.07E-04; Z-score:2.59E+00

Methylation in Case

7.02E-01 (Median) Methylation in Control 6.12E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg23260105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.02E-03; Z-score:2.21E+00

Methylation in Case

9.57E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg05972316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:3.12E-03; Z-score:2.67E+00

Methylation in Case

2.72E-01 (Median) Methylation in Control 2.16E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg00472281)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:3.98E-03; Z-score:-2.99E+00

Methylation in Case

6.48E-01 (Median) Methylation in Control 7.28E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg06593603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.30E-02; Z-score:-2.69E+00

Methylation in Case

4.42E-01 (Median) Methylation in Control 5.10E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg04718185)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.49E-02; Z-score:1.65E+00

Methylation in Case

7.73E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg09517450)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.38E-02; Z-score:-2.99E+00

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg23119827)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:2.55E-02; Z-score:1.42E+00

Methylation in Case

7.99E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg24041118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.60E-02; Z-score:-1.39E+00

Methylation in Case

7.47E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A19 in lung adenocarcinoma [ 14 ]

Location

Body (cg06048662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.92E-02; Z-score:-3.38E+00

Methylation in Case

9.34E-01 (Median) Methylation in Control 9.58E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A19 in panic disorder [ 15 ]

Location

Body (cg04718185)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:3.90E-02; Z-score:6.32E-01

Methylation in Case

2.17E+00 (Median) Methylation in Control 1.84E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Cerebral hemispheric glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC6A19 in cerebral hemispheric glioma than that in healthy individual

Studied Phenotype

Cerebral hemispheric glioma [ICD-11:2A00.5]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000854171; Fold-change:-0.216387134; Z-score:-1.623304533
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Melanoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC6A19 in melanoma than that in healthy individual

Studied Phenotype

Melanoma [ICD-11:2C30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.63E-08; Fold-change:-0.277675735; Z-score:-1.358559569
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Meningioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC6A19 in meningioma than that in healthy individual

Studied Phenotype

Meningioma [ICD-11:2A01.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.81E-46; Fold-change:-0.282843082; Z-score:-1.933108385
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Obesity

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC6A19 in obesity than that in healthy individual

Studied Phenotype

Obesity [ICD-11:5B81]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.03E-22; Fold-change:-0.271383868; Z-score:-2.992487729
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Posterior fossa ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC6A19 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.40E-38; Fold-change:-0.208886065; Z-score:-1.451747797
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC6A19 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.00054778; Fold-change:-0.235713843; Z-score:-4.332870262
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Chordoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC6A19 in chordoma than that in healthy individual

Studied Phenotype

Chordoma [ICD-11:5A61.0]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.73E-06; Fold-change:-0.314265195; Z-score:-2.852475021
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Glioblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC6A19 in glioblastoma than that in healthy individual

Studied Phenotype

Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000538429; Fold-change:-0.304023798; Z-score:-1.169439521
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Peripheral neuroectodermal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC6A19 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.002971332; Fold-change:-0.367568005; Z-score:-1.497377123
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Liver cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC6A19 in liver cancer than that in adjacent tissue

Studied Phenotype

Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:2.01E-09; Fold-change:-0.214670476; Z-score:-2.594277616
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-148b directly targets SLC6A19 [ 16 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-148b miRNA Mature ID miR-148b-3p

miRNA Sequence

UCAGUGCAUCACAGAACUUUGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
4 DNA Methylation Dynamics in Urological Tumors.
5 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Genome-wide Scan for Methylation Profiles in Breast Cancer
10 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
11 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
12 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.