Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0451 Transporter Info | ||||
Gene Name | SLC6A19 | ||||
Transporter Name | Sodium-dependent neutral amino acid transporter B(0)AT1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Colon cancer |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
5'UTR (cg20227806) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:2.28E+00 | Statistic Test | p-value:1.50E-06; Z-score:3.99E+00 | ||
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 1.82E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg10362591) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.65E+00 | Statistic Test | p-value:3.89E-07; Z-score:3.20E+00 | ||
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 3.83E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg01078332) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.43E+00 | Statistic Test | p-value:2.19E-06; Z-score:-2.08E+00 | ||
Methylation in Case |
3.31E-01 (Median) | Methylation in Control | 4.73E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg22685409) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:3.61E-05; Z-score:1.41E+00 | ||
Methylation in Case |
5.22E-01 (Median) | Methylation in Control | 4.15E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg15786180) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.46E+00 | Statistic Test | p-value:7.94E-05; Z-score:2.30E+00 | ||
Methylation in Case |
4.34E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg23391214) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:2.74E-03; Z-score:-1.21E+00 | ||
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 3.09E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg21575465) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:3.19E-03; Z-score:-1.00E+00 | ||
Methylation in Case |
6.92E-01 (Median) | Methylation in Control | 7.37E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
TSS200 (cg26001902) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.82E+00 | Statistic Test | p-value:1.16E-05; Z-score:2.18E+00 | ||
Methylation in Case |
7.23E-01 (Median) | Methylation in Control | 3.97E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
Body (cg22708635) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:1.71E-05; Z-score:1.79E+00 | ||
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 6.31E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
Body (cg20561863) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.48E+00 | Statistic Test | p-value:3.65E-05; Z-score:-2.25E+00 | ||
Methylation in Case |
2.87E-01 (Median) | Methylation in Control | 4.25E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
Body (cg14009098) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.39E+00 | Statistic Test | p-value:4.45E-05; Z-score:2.58E+00 | ||
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 4.36E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
Body (cg03723715) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:1.48E-04; Z-score:-3.10E+00 | ||
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 6.30E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
Body (cg27249906) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.01E-03; Z-score:-1.55E+00 | ||
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.63E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
Body (cg02629157) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.48E-03; Z-score:-1.22E+00 | ||
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
Body (cg00098175) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.65E-03; Z-score:8.27E-01 | ||
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in colon adenocarcinoma | [ 1 ] | |||
Location |
Body (cg04330389) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.77E-03; Z-score:-1.23E+00 | ||
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.51E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
25 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
5'UTR (cg18673401) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.51E+00 | Statistic Test | p-value:1.49E-12; Z-score:1.60E+00 | ||
Methylation in Case |
1.57E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS1500 (cg09696301) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:2.37E+00 | Statistic Test | p-value:1.66E-22; Z-score:3.29E+00 | ||
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 1.01E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS1500 (cg22901008) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.57E-08; Z-score:8.39E-01 | ||
Methylation in Case |
2.37E-01 (Median) | Methylation in Control | 1.94E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS1500 (cg03983336) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:9.72E-07; Z-score:1.49E+00 | ||
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 5.42E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS1500 (cg14535884) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.50E+00 | Statistic Test | p-value:4.21E-06; Z-score:-1.06E+00 | ||
Methylation in Case |
1.39E-01 (Median) | Methylation in Control | 2.08E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS1500 (cg23502298) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:4.86E-02; Z-score:-7.85E-01 | ||
Methylation in Case |
3.42E-01 (Median) | Methylation in Control | 3.91E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS200 (cg01325409) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:2.07E-10; Z-score:-1.66E+00 | ||
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS200 (cg12135976) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.36E+00 | Statistic Test | p-value:1.29E-05; Z-score:9.50E-01 | ||
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 2.13E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS200 (cg12799349) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:2.38E-05; Z-score:-1.24E+00 | ||
Methylation in Case |
1.26E-01 (Median) | Methylation in Control | 1.53E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS200 (cg18153630) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:2.84E-04; Z-score:-1.39E+00 | ||
Methylation in Case |
1.91E-01 (Median) | Methylation in Control | 2.59E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS200 (cg14373018) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.58E-04; Z-score:-5.27E-01 | ||
Methylation in Case |
5.78E-01 (Median) | Methylation in Control | 6.37E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
TSS200 (cg03464896) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.67E-02; Z-score:-1.54E-02 | ||
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
1stExon (cg26923754) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:1.16E-09; Z-score:1.77E+00 | ||
Methylation in Case |
5.89E-01 (Median) | Methylation in Control | 4.82E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg04491808) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.48E-12; Z-score:2.59E+00 | ||
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 5.63E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg12671565) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.26E-12; Z-score:-1.23E+00 | ||
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg06483795) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:2.20E-10; Z-score:1.96E+00 | ||
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg23368787) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:1.07E-08; Z-score:1.81E+00 | ||
Methylation in Case |
5.24E-01 (Median) | Methylation in Control | 4.07E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg22120714) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:2.40E+00 | Statistic Test | p-value:2.44E-06; Z-score:1.32E+00 | ||
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 7.75E-02 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg08701543) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:3.01E-06; Z-score:1.62E+00 | ||
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 6.57E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon20 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg13492826) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:8.32E-04; Z-score:8.75E-01 | ||
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon21 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.71E-03; Z-score:-8.08E-01 | ||
Methylation in Case |
6.82E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon22 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg13849066) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.30E-02; Z-score:-7.29E-03 | ||
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.47E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon23 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg17044311) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.72E-02; Z-score:-3.46E-01 | ||
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon24 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
Body (cg26175729) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:2.16E-02; Z-score:-3.87E-01 | ||
Methylation in Case |
2.58E-01 (Median) | Methylation in Control | 2.94E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon25 |
Methylation of SLC6A19 in pancretic ductal adenocarcinoma | [ 2 ] | |||
Location |
3'UTR (cg24945881) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:8.46E-04; Z-score:-6.90E-01 | ||
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
Location |
5'UTR (cg09300114) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:3.17E+00 | Statistic Test | p-value:2.60E-04; Z-score:1.59E+01 | ||
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 2.41E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
Location |
5'UTR (cg01791587) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:4.09E+00 | Statistic Test | p-value:7.42E-04; Z-score:2.21E+01 | ||
Methylation in Case |
5.96E-01 (Median) | Methylation in Control | 1.46E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
Location |
TSS1500 (cg20313963) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.56E+00 | Statistic Test | p-value:1.39E-03; Z-score:4.14E+00 | ||
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 5.31E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
Location |
TSS1500 (cg24900663) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.92E+00 | Statistic Test | p-value:9.72E-03; Z-score:-2.63E+00 | ||
Methylation in Case |
9.95E-02 (Median) | Methylation in Control | 1.91E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
Location |
TSS200 (cg20095851) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:1.92E-02; Z-score:2.35E+00 | ||
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 7.42E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
Location |
Body (cg24866407) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.34E+00 | Statistic Test | p-value:1.19E-02; Z-score:3.74E+00 | ||
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 6.37E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in prostate cancer | [ 3 ] | |||
Location |
3'UTR (cg10024478) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:2.20E-02; Z-score:1.85E+00 | ||
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
48 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS1500 (cg11123744) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.28E+00 | Statistic Test | p-value:1.77E-10; Z-score:-1.90E+01 | ||
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 5.23E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS1500 (cg26711638) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.38E+00 | Statistic Test | p-value:1.77E-10; Z-score:-9.56E+00 | ||
Methylation in Case |
2.11E-01 (Median) | Methylation in Control | 5.03E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS1500 (cg11325573) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.50E+00 | Statistic Test | p-value:2.05E-09; Z-score:-9.22E+00 | ||
Methylation in Case |
2.54E-01 (Median) | Methylation in Control | 3.82E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS200 (cg02389859) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.89E+00 | Statistic Test | p-value:1.33E-11; Z-score:-1.53E+01 | ||
Methylation in Case |
2.66E-01 (Median) | Methylation in Control | 5.02E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS200 (cg21487099) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.66E+00 | Statistic Test | p-value:9.85E-11; Z-score:-8.59E+00 | ||
Methylation in Case |
3.40E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS200 (cg04309194) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.68E+00 | Statistic Test | p-value:1.01E-10; Z-score:-1.07E+01 | ||
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 6.42E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS200 (cg26948274) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.63E+00 | Statistic Test | p-value:7.32E-10; Z-score:-8.75E+00 | ||
Methylation in Case |
2.86E-01 (Median) | Methylation in Control | 4.67E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS200 (cg09837037) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.74E+00 | Statistic Test | p-value:2.33E-09; Z-score:-7.46E+00 | ||
Methylation in Case |
4.21E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
TSS200 (cg21492882) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.66E+00 | Statistic Test | p-value:8.44E-09; Z-score:-7.25E+00 | ||
Methylation in Case |
3.26E-01 (Median) | Methylation in Control | 5.41E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg02685680) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.88E+00 | Statistic Test | p-value:6.08E-17; Z-score:-1.94E+01 | ||
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg24114651) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.63E+00 | Statistic Test | p-value:1.41E-13; Z-score:-1.90E+01 | ||
Methylation in Case |
2.85E-01 (Median) | Methylation in Control | 7.50E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg24041118) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.04E+00 | Statistic Test | p-value:2.24E-13; Z-score:-3.94E+01 | ||
Methylation in Case |
4.00E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.24E+00 | Statistic Test | p-value:2.97E-13; Z-score:-1.42E+01 | ||
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg09517450) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.03E+00 | Statistic Test | p-value:1.24E-12; Z-score:-2.16E+01 | ||
Methylation in Case |
4.46E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg06556827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:2.57E-10; Z-score:-1.66E+01 | ||
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg20475114) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.57E+00 | Statistic Test | p-value:1.20E-09; Z-score:-2.08E+01 | ||
Methylation in Case |
4.22E-01 (Median) | Methylation in Control | 6.63E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg07010687) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.98E+00 | Statistic Test | p-value:2.52E-09; Z-score:-1.29E+01 | ||
Methylation in Case |
4.06E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg00502885) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.24E+00 | Statistic Test | p-value:4.16E-09; Z-score:-1.51E+01 | ||
Methylation in Case |
3.48E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg05887366) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.53E+00 | Statistic Test | p-value:1.11E-08; Z-score:-1.33E+01 | ||
Methylation in Case |
4.35E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon20 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg19619756) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.47E+00 | Statistic Test | p-value:2.49E-08; Z-score:-1.00E+01 | ||
Methylation in Case |
3.58E-01 (Median) | Methylation in Control | 5.26E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon21 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg02580900) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:2.13E-07; Z-score:-9.05E+00 | ||
Methylation in Case |
4.80E-01 (Median) | Methylation in Control | 6.96E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon22 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg11666857) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.75E+00 | Statistic Test | p-value:2.41E-07; Z-score:-5.74E+00 | ||
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon23 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg04135385) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:7.40E-07; Z-score:-1.01E+01 | ||
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon24 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg09648809) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.16E-06; Z-score:-5.87E+00 | ||
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon25 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg20706711) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.55E+00 | Statistic Test | p-value:4.79E-06; Z-score:-6.39E+00 | ||
Methylation in Case |
4.04E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon26 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg05005358) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:8.13E-06; Z-score:-4.65E+00 | ||
Methylation in Case |
5.81E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon27 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg23260105) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:2.57E-05; Z-score:-8.99E+00 | ||
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon28 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg26537272) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:9.49E-05; Z-score:-1.14E+01 | ||
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon29 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg22165524) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.13E-04; Z-score:-8.02E+00 | ||
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon30 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg23119827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.84E-04; Z-score:-4.27E+00 | ||
Methylation in Case |
5.99E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon31 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg10800865) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:2.53E-04; Z-score:-8.88E+00 | ||
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon32 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg11842953) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.78E-04; Z-score:-8.23E+00 | ||
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon33 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg03807914) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:5.03E-04; Z-score:-4.27E+00 | ||
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon34 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg10979994) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:6.99E-04; Z-score:-7.11E+00 | ||
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon35 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg04553355) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.32E-04; Z-score:-2.97E+00 | ||
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon36 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg16367697) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.16E-03; Z-score:-6.62E+00 | ||
Methylation in Case |
7.27E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon37 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg04718185) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:1.45E-03; Z-score:-3.87E+00 | ||
Methylation in Case |
5.67E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon38 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg15142890) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.47E-03; Z-score:-2.52E+00 | ||
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon39 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg06048662) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.58E-03; Z-score:-2.72E+00 | ||
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon40 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg06593603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.48E+00 | Statistic Test | p-value:1.88E-03; Z-score:-3.80E+00 | ||
Methylation in Case |
2.96E-01 (Median) | Methylation in Control | 4.38E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon41 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg22632352) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:3.86E-03; Z-score:-4.78E+00 | ||
Methylation in Case |
5.45E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon42 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg01840128) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.22E-02; Z-score:-8.18E-01 | ||
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon43 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg02327812) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.42E-02; Z-score:-5.71E-03 | ||
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon44 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
Body (cg10035234) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:4.35E-02; Z-score:7.31E-02 | ||
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon45 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
3'UTR (cg18515046) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:7.77E-05; Z-score:-3.96E+00 | ||
Methylation in Case |
4.66E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon46 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
3'UTR (cg26197930) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:8.60E-05; Z-score:-3.39E+00 | ||
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.38E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon47 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
3'UTR (cg04248937) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.18E-02; Z-score:-2.69E+00 | ||
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon48 |
Methylation of SLC6A19 in bladder cancer | [ 4 ] | |||
Location |
3'UTR (cg26498616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.19E-02; Z-score:-1.19E+00 | ||
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Depression |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in depression | [ 5 ] | |||
Location |
TSS1500 (cg11123744) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.52E-02; Z-score:6.90E-01 | ||
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 6.18E-01 (Median) | ||
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in depression | [ 5 ] | |||
Location |
TSS200 (cg09837037) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.46E-02; Z-score:3.73E-01 | ||
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in depression | [ 5 ] | |||
Location |
Body (cg24114651) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.21E-02; Z-score:5.17E-01 | ||
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
30 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
TSS1500 (cg26711638) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:5.93E-03; Z-score:-7.71E-01 | ||
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 4.75E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
TSS200 (cg26763542) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.63E+00 | Statistic Test | p-value:2.55E-18; Z-score:-6.55E+00 | ||
Methylation in Case |
4.31E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
TSS200 (cg06517798) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:2.36E-14; Z-score:-8.74E+00 | ||
Methylation in Case |
5.93E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
TSS200 (cg27056599) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:3.76E+00 | Statistic Test | p-value:3.89E-12; Z-score:7.14E+00 | ||
Methylation in Case |
3.32E-01 (Median) | Methylation in Control | 8.83E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
TSS200 (cg27619475) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:1.39E-11; Z-score:1.70E+00 | ||
Methylation in Case |
5.64E-01 (Median) | Methylation in Control | 4.23E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
TSS200 (cg26948274) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:5.39E-04; Z-score:-1.06E+00 | ||
Methylation in Case |
4.47E-01 (Median) | Methylation in Control | 5.17E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
TSS200 (cg02389859) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:8.51E-04; Z-score:-1.30E+00 | ||
Methylation in Case |
4.67E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg24266851) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.48E+00 | Statistic Test | p-value:7.48E-19; Z-score:-3.01E+00 | ||
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg18948221) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:5.36E-14; Z-score:-4.97E+00 | ||
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg14502431) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:4.34E-12; Z-score:-8.31E+00 | ||
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg16367697) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:2.81E-08; Z-score:-1.26E+00 | ||
Methylation in Case |
6.53E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg20706711) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:3.78E-08; Z-score:-1.76E+00 | ||
Methylation in Case |
6.23E-01 (Median) | Methylation in Control | 7.19E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg22165524) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.98E-08; Z-score:-2.03E+00 | ||
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 8.83E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:9.08E-08; Z-score:-2.22E+00 | ||
Methylation in Case |
5.81E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg10035234) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.08E-07; Z-score:-2.91E+00 | ||
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg22632352) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:5.30E-07; Z-score:-1.32E+00 | ||
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg15142890) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.12E-06; Z-score:-2.32E+00 | ||
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg04553355) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.35E-06; Z-score:-1.86E+00 | ||
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg05887366) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.26E-06; Z-score:-1.11E+00 | ||
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon20 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg04718185) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:3.89E-06; Z-score:-1.51E+00 | ||
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon21 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg26537272) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.29E-05; Z-score:-8.78E-01 | ||
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon22 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg12562822) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.11E+00 | Statistic Test | p-value:1.08E-04; Z-score:-5.45E-01 | ||
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 2.86E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon23 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg10800865) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.42E-04; Z-score:-8.47E-01 | ||
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon24 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg01840128) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.39E-03; Z-score:-3.09E-01 | ||
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon25 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg24041118) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:4.49E-02; Z-score:3.56E-01 | ||
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon26 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
3'UTR (cg12757078) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:1.98E-12; Z-score:-2.28E+00 | ||
Methylation in Case |
5.46E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon27 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
3'UTR (cg26498616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.20E-08; Z-score:-2.38E+00 | ||
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon28 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
3'UTR (cg26197930) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.48E-06; Z-score:-5.91E-01 | ||
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon29 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
3'UTR (cg22599115) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.14E-03; Z-score:-5.27E-01 | ||
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.42E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon30 |
Methylation of SLC6A19 in hepatocellular carcinoma | [ 6 ] | |||
Location |
3'UTR (cg04248937) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:7.16E-03; Z-score:-4.35E-01 | ||
Methylation in Case |
6.32E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
TSS1500 (cg11123744) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.22E-02; Z-score:3.86E-01 | ||
Methylation in Case |
7.08E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
TSS200 (cg04309194) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:5.84E-03; Z-score:7.18E-01 | ||
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg10979994) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.64E-05; Z-score:8.03E-01 | ||
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg20475114) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.92E-04; Z-score:-1.36E+00 | ||
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg03807914) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.13E-04; Z-score:7.89E-01 | ||
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg10800865) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.44E-03; Z-score:4.87E-01 | ||
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg06048662) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.86E-03; Z-score:4.11E-01 | ||
Methylation in Case |
9.73E-01 (Median) | Methylation in Control | 9.66E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg24041118) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.06E-03; Z-score:-1.12E+00 | ||
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg24114651) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.19E-03; Z-score:-7.30E-01 | ||
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg05972316) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:5.91E-03; Z-score:1.03E+00 | ||
Methylation in Case |
2.21E-01 (Median) | Methylation in Control | 1.83E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg10035234) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:9.79E-03; Z-score:7.51E-01 | ||
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg09648809) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.01E-02; Z-score:7.92E-01 | ||
Methylation in Case |
9.73E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg06593603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.02E-02; Z-score:-4.75E-01 | ||
Methylation in Case |
4.32E-01 (Median) | Methylation in Control | 4.73E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.15E-02; Z-score:-1.03E+00 | ||
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in HIV infection | [ 7 ] | |||
Location |
Body (cg00502885) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.74E-02; Z-score:-3.22E-01 | ||
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
28 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
TSS1500 (cg26711638) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.17E-02; Z-score:-4.86E-01 | ||
Methylation in Case |
2.58E-01 (Median) | Methylation in Control | 2.92E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
TSS1500 (cg11123744) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.31E-02; Z-score:3.03E-01 | ||
Methylation in Case |
2.77E-01 (Median) | Methylation in Control | 2.58E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
TSS200 (cg21492882) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:1.57E-03; Z-score:1.04E+00 | ||
Methylation in Case |
4.94E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
TSS200 (cg09837037) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:4.40E-03; Z-score:1.37E+00 | ||
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg07010687) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:8.31E-15; Z-score:-3.15E+00 | ||
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg24114651) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:9.14E-12; Z-score:-2.73E+00 | ||
Methylation in Case |
7.58E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg05005358) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.48E-11; Z-score:-2.38E+00 | ||
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg06556827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:5.70E-11; Z-score:-3.39E+00 | ||
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:7.02E-11; Z-score:-1.90E+00 | ||
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg02580900) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.07E-09; Z-score:-1.86E+00 | ||
Methylation in Case |
7.23E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg20475114) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.71E-07; Z-score:-1.21E+00 | ||
Methylation in Case |
7.22E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg03807914) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.86E-06; Z-score:-1.16E+00 | ||
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg04135385) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.41E-05; Z-score:-1.16E+00 | ||
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg04553355) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.38E-05; Z-score:-9.40E-01 | ||
Methylation in Case |
9.43E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg06048662) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.41E-04; Z-score:-7.43E-01 | ||
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg24041118) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:7.38E-04; Z-score:-2.83E-01 | ||
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 7.15E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg02685680) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:8.72E-04; Z-score:-5.49E-01 | ||
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg10979994) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:8.80E-04; Z-score:-6.59E-01 | ||
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg09648809) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.27E-03; Z-score:-2.62E-01 | ||
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon20 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg05887366) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.57E-03; Z-score:-4.70E-01 | ||
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon21 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg23119827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.42E-03; Z-score:-3.86E-01 | ||
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon22 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg16367697) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:6.41E-03; Z-score:-3.58E-01 | ||
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon23 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg19619756) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:6.87E-03; Z-score:-5.02E-01 | ||
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 5.80E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon24 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg23000153) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.26E-02; Z-score:-4.54E-01 | ||
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon25 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg00502885) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.50E-02; Z-score:-2.94E-01 | ||
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon26 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg15142890) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.56E-02; Z-score:-3.35E-01 | ||
Methylation in Case |
9.39E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon27 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg10035234) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.26E-02; Z-score:-7.59E-01 | ||
Methylation in Case |
9.12E-01 (Median) | Methylation in Control | 9.25E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon28 |
Methylation of SLC6A19 in papillary thyroid cancer | [ 8 ] | |||
Location |
3'UTR (cg26197930) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.39E-02; Z-score:-2.24E-01 | ||
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
TSS200 (cg09837037) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.47E-02; Z-score:-1.08E+00 | ||
Methylation in Case |
6.11E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg20475114) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:3.35E-14; Z-score:-2.70E+00 | ||
Methylation in Case |
5.00E-01 (Median) | Methylation in Control | 6.10E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg23119827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.35E-13; Z-score:2.18E+00 | ||
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg07010687) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:2.08E-11; Z-score:-2.56E+00 | ||
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.59E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg05972316) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:7.00E-11; Z-score:1.92E+00 | ||
Methylation in Case |
1.95E-01 (Median) | Methylation in Control | 1.42E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg05005358) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.62E-07; Z-score:-1.53E+00 | ||
Methylation in Case |
6.83E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg06593603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:1.94E-06; Z-score:-2.22E+00 | ||
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 4.34E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg19619756) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.97E-06; Z-score:-1.28E+00 | ||
Methylation in Case |
4.73E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg02580900) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:2.12E-06; Z-score:-1.52E+00 | ||
Methylation in Case |
5.69E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg16367697) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.81E-06; Z-score:-6.16E-01 | ||
Methylation in Case |
7.13E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg10979994) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:4.82E-06; Z-score:-1.36E+00 | ||
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg06048662) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:8.45E-06; Z-score:-1.36E+00 | ||
Methylation in Case |
9.13E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg24041118) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:1.66E-05; Z-score:-2.01E+00 | ||
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 6.63E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg09648809) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.28E-05; Z-score:-1.35E+00 | ||
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg03807914) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.13E-04; Z-score:-1.12E+00 | ||
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg04135385) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.85E-04; Z-score:-1.11E+00 | ||
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg04553355) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.97E-04; Z-score:-9.13E-01 | ||
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg23260105) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.10E-04; Z-score:-7.60E-01 | ||
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg02685680) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:4.25E-04; Z-score:-1.40E+00 | ||
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon20 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg11666857) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:6.11E-04; Z-score:-7.92E-01 | ||
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon21 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.49E-03; Z-score:-1.03E+00 | ||
Methylation in Case |
5.01E-01 (Median) | Methylation in Control | 5.40E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon22 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg09517450) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:3.27E-03; Z-score:-1.03E+00 | ||
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon23 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg10035234) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.61E-03; Z-score:4.84E-01 | ||
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon24 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg01840128) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.72E-03; Z-score:-1.58E-02 | ||
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon25 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg04718185) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.11E-02; Z-score:-4.69E-01 | ||
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon26 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg25582398) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:3.89E-02; Z-score:-7.94E-01 | ||
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon27 |
Methylation of SLC6A19 in breast cancer | [ 9 ] | |||
Location |
Body (cg11842953) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.49E-02; Z-score:-6.12E-01 | ||
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal cell carcinoma |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
TSS200 (cg02389859) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:1.83E-05; Z-score:-2.83E+00 | ||
Methylation in Case |
5.31E-01 (Median) | Methylation in Control | 6.38E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
TSS200 (cg26948274) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:6.93E-04; Z-score:-2.02E+00 | ||
Methylation in Case |
5.24E-01 (Median) | Methylation in Control | 5.96E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
TSS200 (cg21487099) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.66E-02; Z-score:-1.37E+00 | ||
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 6.59E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg01840128) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.32E+00 | Statistic Test | p-value:9.12E-08; Z-score:5.91E+00 | ||
Methylation in Case |
7.79E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg04553355) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.24E-06; Z-score:-1.54E+00 | ||
Methylation in Case |
9.68E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg07010687) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:2.00E-06; Z-score:-3.04E+00 | ||
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg04718185) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:3.35E-05; Z-score:3.42E+00 | ||
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg23260105) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.20E-04; Z-score:2.29E+00 | ||
Methylation in Case |
9.70E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg06556827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.23E-04; Z-score:-1.04E+00 | ||
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg20706711) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:1.57E-04; Z-score:2.89E+00 | ||
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg22632352) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.21E-04; Z-score:2.51E+00 | ||
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg11666857) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.30E-02; Z-score:1.95E+00 | ||
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 6.50E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg02580900) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.71E-02; Z-score:-5.72E-01 | ||
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg19619756) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.81E-02; Z-score:9.47E-01 | ||
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 5.49E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg10979994) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.89E-02; Z-score:-6.80E-01 | ||
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg06593603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.90E-02; Z-score:1.55E+00 | ||
Methylation in Case |
4.74E-01 (Median) | Methylation in Control | 4.00E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg20475114) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.13E-02; Z-score:-3.75E-01 | ||
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg00502885) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.12E-02; Z-score:-4.59E-01 | ||
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC6A19 in clear cell renal cell carcinoma | [ 10 ] | |||
Location |
Body (cg06048662) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.54E-02; Z-score:-4.52E-01 | ||
Methylation in Case |
9.74E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
33 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
TSS200 (cg26948274) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.20E-02; Z-score:-8.23E-01 | ||
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg07010687) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:5.91E-14; Z-score:-6.61E+00 | ||
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg20475114) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:2.71E-13; Z-score:-4.51E+00 | ||
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg24114651) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:1.72E-12; Z-score:-5.76E+00 | ||
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg02580900) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.96E-11; Z-score:-3.70E+00 | ||
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg05005358) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.49E-07; Z-score:-2.73E+00 | ||
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg23260105) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:6.41E-07; Z-score:-3.04E+00 | ||
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.74E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg10979994) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:8.22E-07; Z-score:-2.79E+00 | ||
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg05972316) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:1.13E-06; Z-score:1.31E+00 | ||
Methylation in Case |
2.67E-01 (Median) | Methylation in Control | 2.23E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg11666857) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.65E-06; Z-score:-1.45E+00 | ||
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg10800865) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:7.30E-06; Z-score:-3.59E+00 | ||
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg06556827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.25E-06; Z-score:-2.17E+00 | ||
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg05887366) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.18E-05; Z-score:-7.57E-01 | ||
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg06048662) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.92E-05; Z-score:-1.47E+00 | ||
Methylation in Case |
9.64E-01 (Median) | Methylation in Control | 9.73E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg06593603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.58E+00 | Statistic Test | p-value:3.27E-05; Z-score:-1.15E+00 | ||
Methylation in Case |
2.93E-01 (Median) | Methylation in Control | 4.63E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg20706711) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.57E-05; Z-score:-1.64E+00 | ||
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg16367697) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.01E-04; Z-score:-1.62E+00 | ||
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg00502885) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.88E-04; Z-score:-7.09E-01 | ||
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg09648809) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.18E-04; Z-score:-8.92E-01 | ||
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon20 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg23119827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.42E-03; Z-score:-7.83E-01 | ||
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon21 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg11842953) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.52E-03; Z-score:-7.01E-01 | ||
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon22 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg03807914) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.71E-03; Z-score:-5.44E-01 | ||
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon23 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.70E-03; Z-score:-2.90E-01 | ||
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon24 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg12562822) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.25E+00 | Statistic Test | p-value:8.12E-03; Z-score:-6.56E-01 | ||
Methylation in Case |
9.41E-02 (Median) | Methylation in Control | 2.11E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon25 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg01840128) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.64E-02; Z-score:1.25E+00 | ||
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon26 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg25582398) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.73E-02; Z-score:-1.37E-01 | ||
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon27 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg23000153) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.68E-02; Z-score:7.45E-01 | ||
Methylation in Case |
9.07E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon28 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg26537272) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.88E-02; Z-score:-3.14E-01 | ||
Methylation in Case |
9.36E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon29 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg24041118) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:4.24E-02; Z-score:-5.44E-01 | ||
Methylation in Case |
6.92E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon30 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
Body (cg15142890) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.36E-02; Z-score:-1.01E-01 | ||
Methylation in Case |
9.55E-01 (Median) | Methylation in Control | 9.55E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon31 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
3'UTR (cg22599115) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.78E-03; Z-score:-5.53E-01 | ||
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.51E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon32 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
3'UTR (cg04248937) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:8.31E-03; Z-score:5.12E-01 | ||
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon33 |
Methylation of SLC6A19 in colorectal cancer | [ 11 ] | |||
Location |
3'UTR (cg26498616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.40E-02; Z-score:-5.12E-01 | ||
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.61E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Systemic lupus erythematosus |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
TSS200 (cg02389859) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.76E-03; Z-score:-1.95E-01 | ||
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
TSS200 (cg26948274) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.30E-02; Z-score:-1.04E-01 | ||
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 7.45E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg11842953) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.04E-03; Z-score:-2.32E-01 | ||
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg02327812) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.26E-03; Z-score:-5.41E-02 | ||
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg02580900) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.81E-03; Z-score:-2.04E-01 | ||
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg05005358) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.33E-02; Z-score:-1.86E-01 | ||
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.80E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg02685680) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.62E-02; Z-score:-1.30E-01 | ||
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg04553355) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.34E-02; Z-score:-4.58E-02 | ||
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg04718185) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.00E-02; Z-score:-1.72E-01 | ||
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg20706711) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.24E-02; Z-score:-2.06E-01 | ||
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in systemic lupus erythematosus | [ 12 ] | |||
Location |
Body (cg06593603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.30E-02; Z-score:-1.77E-01 | ||
Methylation in Case |
2.83E-01 (Median) | Methylation in Control | 3.09E-01 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
30 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.67E-05; Z-score:5.63E-01 | ||
Methylation in Case |
9.68E-02 (Median) | Methylation in Control | 8.93E-02 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg00502885) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:2.75E-05; Z-score:-1.15E+00 | ||
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg01840128) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.45E+00 | Statistic Test | p-value:9.00E-05; Z-score:-1.48E+00 | ||
Methylation in Case |
2.18E-01 (Median) | Methylation in Control | 5.35E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg02327812) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.44E-04; Z-score:5.90E-01 | ||
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 2.26E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg02580900) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:1.79E-04; Z-score:1.02E+00 | ||
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 6.96E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg02685680) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:2.08E-04; Z-score:5.64E-01 | ||
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg03807914) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:4.39E-04; Z-score:1.16E+00 | ||
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 7.25E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg04135385) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.81E+00 | Statistic Test | p-value:5.65E-04; Z-score:-3.63E-01 | ||
Methylation in Case |
4.07E-02 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg04553355) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:8.64E-04; Z-score:-6.87E-01 | ||
Methylation in Case |
7.10E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg04718185) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:9.36E-04; Z-score:-9.30E-01 | ||
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg05005358) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.48E+00 | Statistic Test | p-value:1.17E-03; Z-score:-5.06E-01 | ||
Methylation in Case |
3.83E-02 (Median) | Methylation in Control | 9.47E-02 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon12 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg05887366) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:1.76E-03; Z-score:-7.26E-01 | ||
Methylation in Case |
4.70E-01 (Median) | Methylation in Control | 5.63E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon13 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg05972316) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.97E-03; Z-score:-4.84E-01 | ||
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.12E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon14 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg06048662) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:2.10E-03; Z-score:1.21E+00 | ||
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon15 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg06556827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.72E+00 | Statistic Test | p-value:2.54E-03; Z-score:-6.85E-01 | ||
Methylation in Case |
5.75E-02 (Median) | Methylation in Control | 9.87E-02 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon16 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg06593603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.65E-03; Z-score:-6.41E-01 | ||
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 6.60E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg07010687) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.48E+00 | Statistic Test | p-value:3.23E-03; Z-score:1.11E+00 | ||
Methylation in Case |
6.76E-01 (Median) | Methylation in Control | 4.57E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon18 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg09517450) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.09E-02; Z-score:-5.49E-01 | ||
Methylation in Case |
9.61E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon19 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg09648809) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:1.15E-02; Z-score:1.18E+00 | ||
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 7.04E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon20 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg10035234) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.35E-02; Z-score:4.26E-01 | ||
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon21 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg10800865) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:1.82E-02; Z-score:-8.16E-01 | ||
Methylation in Case |
2.03E-01 (Median) | Methylation in Control | 2.60E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon22 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg10979994) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.96E-02; Z-score:-2.59E-01 | ||
Methylation in Case |
9.59E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon23 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg11666857) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.40E-02; Z-score:4.19E-01 | ||
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon24 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg11842953) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.54E-02; Z-score:-2.72E-01 | ||
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon25 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
Body (cg12562822) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:2.81E-02; Z-score:-7.14E-01 | ||
Methylation in Case |
1.58E-01 (Median) | Methylation in Control | 2.06E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon26 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
3'UTR (cg04248937) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:2.75E-14; Z-score:-2.26E+00 | ||
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 7.49E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon27 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
3'UTR (cg18515046) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.46E+00 | Statistic Test | p-value:1.67E-10; Z-score:1.74E+00 | ||
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 5.71E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon28 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
3'UTR (cg22599115) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:6.15E-10; Z-score:-1.89E+00 | ||
Methylation in Case |
6.35E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon29 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
3'UTR (cg26197930) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:2.73E-09; Z-score:-1.58E+00 | ||
Methylation in Case |
6.91E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon30 |
Methylation of SLC6A19 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
Location |
3'UTR (cg26498616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:2.79E-09; Z-score:-1.48E+00 | ||
Methylation in Case |
4.79E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg20706711) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:4.07E-04; Z-score:2.59E+00 | ||
Methylation in Case |
7.02E-01 (Median) | Methylation in Control | 6.12E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg23260105) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.02E-03; Z-score:2.21E+00 | ||
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg05972316) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:3.12E-03; Z-score:2.67E+00 | ||
Methylation in Case |
2.72E-01 (Median) | Methylation in Control | 2.16E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg00472281) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.98E-03; Z-score:-2.99E+00 | ||
Methylation in Case |
6.48E-01 (Median) | Methylation in Control | 7.28E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg06593603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.30E-02; Z-score:-2.69E+00 | ||
Methylation in Case |
4.42E-01 (Median) | Methylation in Control | 5.10E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg04718185) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.49E-02; Z-score:1.65E+00 | ||
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg09517450) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.38E-02; Z-score:-2.99E+00 | ||
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg23119827) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:2.55E-02; Z-score:1.42E+00 | ||
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg24041118) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.60E-02; Z-score:-1.39E+00 | ||
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC6A19 in lung adenocarcinoma | [ 14 ] | |||
Location |
Body (cg06048662) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.92E-02; Z-score:-3.38E+00 | ||
Methylation in Case |
9.34E-01 (Median) | Methylation in Control | 9.58E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC6A19 in panic disorder | [ 15 ] | |||
Location |
Body (cg04718185) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:3.90E-02; Z-score:6.32E-01 | ||
Methylation in Case |
2.17E+00 (Median) | Methylation in Control | 1.84E+00 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Cerebral hemispheric glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC6A19 in cerebral hemispheric glioma than that in healthy individual | ||||
Studied Phenotype |
Cerebral hemispheric glioma [ICD-11:2A00.5] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000854171; Fold-change:-0.216387134; Z-score:-1.623304533 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Melanoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC6A19 in melanoma than that in healthy individual | ||||
Studied Phenotype |
Melanoma [ICD-11:2C30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.63E-08; Fold-change:-0.277675735; Z-score:-1.358559569 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Meningioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC6A19 in meningioma than that in healthy individual | ||||
Studied Phenotype |
Meningioma [ICD-11:2A01.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:5.81E-46; Fold-change:-0.282843082; Z-score:-1.933108385 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Obesity |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC6A19 in obesity than that in healthy individual | ||||
Studied Phenotype |
Obesity [ICD-11:5B81] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:5.03E-22; Fold-change:-0.271383868; Z-score:-2.992487729 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC6A19 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:5.40E-38; Fold-change:-0.208886065; Z-score:-1.451747797 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC6A19 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.00054778; Fold-change:-0.235713843; Z-score:-4.332870262 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Chordoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC6A19 in chordoma than that in healthy individual | ||||
Studied Phenotype |
Chordoma [ICD-11:5A61.0] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.73E-06; Fold-change:-0.314265195; Z-score:-2.852475021 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Glioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC6A19 in glioblastoma than that in healthy individual | ||||
Studied Phenotype |
Glioblastoma [ICD-11:2A00.00] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000538429; Fold-change:-0.304023798; Z-score:-1.169439521 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Peripheral neuroectodermal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC6A19 in peripheral neuroectodermal tumour than that in healthy individual | ||||
Studied Phenotype |
Peripheral neuroectodermal tumour [ICD-11:2B52] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.002971332; Fold-change:-0.367568005; Z-score:-1.497377123 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Liver cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC6A19 in liver cancer than that in adjacent tissue | ||||
Studied Phenotype |
Liver cancer [ICD-11:2C12] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:2.01E-09; Fold-change:-0.214670476; Z-score:-2.594277616 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
![]() |
![]() | ||||
microRNA |
|||||
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-148b directly targets SLC6A19 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-148b | miRNA Mature ID | miR-148b-3p | ||
miRNA Sequence |
UCAGUGCAUCACAGAACUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.