Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0449 Transporter Info | ||||
| Gene Name | SLC6A17 | ||||
| Transporter Name | Sodium-dependent neurotransmitter transporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.43E+00 | Statistic Test | p-value:1.15E-08; Z-score:-1.80E+00 | ||
|
Methylation in Case |
5.11E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.50E-08; Z-score:-1.71E+00 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.55E+00 | Statistic Test | p-value:4.76E-08; Z-score:-1.64E+00 | ||
|
Methylation in Case |
3.58E-01 (Median) | Methylation in Control | 5.55E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.44E+00 | Statistic Test | p-value:5.13E-08; Z-score:1.65E+00 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:4.82E-07; Z-score:1.13E+00 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 5.89E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.15E-06; Z-score:-1.27E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:2.48E-04; Z-score:-6.33E-01 | ||
|
Methylation in Case |
3.38E-01 (Median) | Methylation in Control | 4.47E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:6.13E-04; Z-score:-5.26E-01 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.43E-03; Z-score:-6.04E-01 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:4.45E-03; Z-score:9.73E-01 | ||
|
Methylation in Case |
7.26E-01 (Median) | Methylation in Control | 6.04E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg11828251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.54E-02; Z-score:-3.38E-01 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 1.65E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.66E-02; Z-score:3.55E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC6A17 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.54E+00 | Statistic Test | p-value:4.39E-10; Z-score:-2.01E+00 | ||
|
Methylation in Case |
4.36E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.81E+00 | Statistic Test | p-value:1.14E-05; Z-score:-3.58E+00 | ||
|
Methylation in Case |
8.91E-02 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.87E+00 | Statistic Test | p-value:3.31E-05; Z-score:7.06E+00 | ||
|
Methylation in Case |
2.46E-01 (Median) | Methylation in Control | 1.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.12E+00 | Statistic Test | p-value:3.95E-05; Z-score:8.12E+00 | ||
|
Methylation in Case |
2.21E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.39E+00 | Statistic Test | p-value:4.81E-04; Z-score:4.05E+00 | ||
|
Methylation in Case |
4.87E-01 (Median) | Methylation in Control | 3.50E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.11E+00 | Statistic Test | p-value:1.33E-03; Z-score:2.46E+00 | ||
|
Methylation in Case |
3.57E-02 (Median) | Methylation in Control | 1.70E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:1.07E-02; Z-score:-2.53E+00 | ||
|
Methylation in Case |
2.62E-01 (Median) | Methylation in Control | 3.53E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.74E+00 | Statistic Test | p-value:1.08E-07; Z-score:-6.93E+00 | ||
|
Methylation in Case |
8.90E-02 (Median) | Methylation in Control | 2.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg17032646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.64E+00 | Statistic Test | p-value:1.15E-06; Z-score:7.83E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg10761097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:1.29E-06; Z-score:-1.35E+01 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg23235497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:7.51E-03; Z-score:3.57E+00 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 2.99E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg11828251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:1.36E-06; Z-score:-4.57E+00 | ||
|
Methylation in Case |
5.14E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.57E+00 | Statistic Test | p-value:2.08E-06; Z-score:-6.29E+00 | ||
|
Methylation in Case |
4.15E-01 (Median) | Methylation in Control | 6.50E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg19866406) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:2.89E-06; Z-score:-1.68E+01 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:5.70E-06; Z-score:-7.99E+00 | ||
|
Methylation in Case |
5.55E-01 (Median) | Methylation in Control | 7.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.64E-05; Z-score:-1.25E+01 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.57E+00 | Statistic Test | p-value:8.05E-05; Z-score:-3.82E+00 | ||
|
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.03E-04; Z-score:-3.43E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC6A17 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.58E+00 | Statistic Test | p-value:7.13E-08; Z-score:-1.04E+01 | ||
|
Methylation in Case |
4.44E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.60E+00 | Statistic Test | p-value:1.47E-11; Z-score:2.41E+00 | ||
|
Methylation in Case |
1.58E-01 (Median) | Methylation in Control | 9.87E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:8.43E-06; Z-score:9.76E-01 | ||
|
Methylation in Case |
3.33E-02 (Median) | Methylation in Control | 2.30E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:5.91E-04; Z-score:1.12E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 4.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:6.80E-03; Z-score:-9.93E-01 | ||
|
Methylation in Case |
2.23E-01 (Median) | Methylation in Control | 3.23E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.40E-02; Z-score:4.69E-01 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 3.10E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.60E+00 | Statistic Test | p-value:2.31E-13; Z-score:-1.99E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 2.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg10761097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.28E-12; Z-score:-3.42E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg23235497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:4.42E-08; Z-score:1.11E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 3.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg17032646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:5.04E-05; Z-score:7.85E-01 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 4.09E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.07E+00 | Statistic Test | p-value:4.03E-06; Z-score:1.26E+00 | ||
|
Methylation in Case |
4.14E-02 (Median) | Methylation in Control | 2.00E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:1.20E-09; Z-score:-1.96E+00 | ||
|
Methylation in Case |
5.15E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.99E-07; Z-score:-1.34E+00 | ||
|
Methylation in Case |
7.16E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:2.57E-07; Z-score:-1.87E+00 | ||
|
Methylation in Case |
5.84E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg11828251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.45E-07; Z-score:-1.27E+00 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.07E-05; Z-score:-9.36E-01 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC6A17 in breast cancer | [ 3 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:1.49E-13; Z-score:-2.67E+00 | ||
|
Methylation in Case |
6.16E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.64E+00 | Statistic Test | p-value:1.23E-05; Z-score:1.46E+00 | ||
|
Methylation in Case |
8.51E-02 (Median) | Methylation in Control | 5.18E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.75E+00 | Statistic Test | p-value:1.43E-05; Z-score:2.60E+00 | ||
|
Methylation in Case |
8.34E-02 (Median) | Methylation in Control | 4.76E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:1.10E-03; Z-score:3.00E+00 | ||
|
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 4.26E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:3.98E-03; Z-score:5.99E-01 | ||
|
Methylation in Case |
1.92E-02 (Median) | Methylation in Control | 1.75E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.71E+00 | Statistic Test | p-value:3.98E-02; Z-score:-2.09E+00 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.10E+00 | Statistic Test | p-value:1.17E-19; Z-score:4.82E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 2.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+01 | Statistic Test | p-value:1.59E-19; Z-score:1.17E+01 | ||
|
Methylation in Case |
3.49E-01 (Median) | Methylation in Control | 3.11E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.70E+00 | Statistic Test | p-value:2.83E-09; Z-score:2.29E+00 | ||
|
Methylation in Case |
5.83E-01 (Median) | Methylation in Control | 3.43E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:5.19E-08; Z-score:1.98E+00 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 6.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:4.67E-04; Z-score:-1.67E+00 | ||
|
Methylation in Case |
2.06E-01 (Median) | Methylation in Control | 2.81E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:3.05E-03; Z-score:-1.50E+00 | ||
|
Methylation in Case |
5.17E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg10761097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.13E-05; Z-score:-9.10E-01 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg17032646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.06E-04; Z-score:9.49E-01 | ||
|
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 5.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.74E+00 | Statistic Test | p-value:9.73E-13; Z-score:9.35E+00 | ||
|
Methylation in Case |
1.95E-01 (Median) | Methylation in Control | 5.21E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:3.90E-14; Z-score:-3.42E+00 | ||
|
Methylation in Case |
6.65E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:7.95E-07; Z-score:-1.54E+00 | ||
|
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.44E-06; Z-score:-3.72E+00 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg19866406) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:5.93E-06; Z-score:-2.77E+00 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg11828251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.49E-04; Z-score:-1.42E+00 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.10E-03; Z-score:-6.17E-01 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC6A17 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.94E-12; Z-score:-3.44E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Moderate hypermethylation of SLC6A17 in colorectal cancer than that in healthy individual | ||||
Studied Phenotype |
Colorectal cancer [ICD-11:2B91] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.02E-20; Fold-change:0.241366751; Z-score:2.59949617 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Depression |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in depression | [ 6 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.95E-02; Z-score:4.68E-01 | ||
|
Methylation in Case |
3.56E-01 (Median) | Methylation in Control | 3.31E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in depression | [ 6 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.88E-02; Z-score:-5.21E-01 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:1.96E-04; Z-score:2.17E-01 | ||
|
Methylation in Case |
2.99E-02 (Median) | Methylation in Control | 2.72E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:6.10E-04; Z-score:2.63E-01 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.10E-02; Z-score:2.35E-01 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 1.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:3.84E-02; Z-score:-1.18E+00 | ||
|
Methylation in Case |
2.74E-01 (Median) | Methylation in Control | 3.22E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg09312996) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:5.62E-10; Z-score:-1.86E+00 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 6.26E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg10761097) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.05E-05; Z-score:-9.94E-01 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:2.09E-03; Z-score:-6.77E-01 | ||
|
Methylation in Case |
1.41E-01 (Median) | Methylation in Control | 1.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg23235497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.20E-02; Z-score:-7.42E-01 | ||
|
Methylation in Case |
3.11E-01 (Median) | Methylation in Control | 3.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg02244028) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:7.11E-12; Z-score:-4.03E+00 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:4.40E-03; Z-score:1.29E-01 | ||
|
Methylation in Case |
4.10E-02 (Median) | Methylation in Control | 3.88E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.84E+00 | Statistic Test | p-value:9.14E-19; Z-score:-6.45E+00 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg11842953) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.64E+00 | Statistic Test | p-value:1.53E-15; Z-score:-8.59E+00 | ||
|
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg06622573) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:1.21E-11; Z-score:-4.56E+00 | ||
|
Methylation in Case |
5.12E-01 (Median) | Methylation in Control | 6.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg09050160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.56E+00 | Statistic Test | p-value:8.76E-10; Z-score:-1.92E+00 | ||
|
Methylation in Case |
2.78E-01 (Median) | Methylation in Control | 4.32E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.42E-09; Z-score:-2.29E+00 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg07598082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.81E-06; Z-score:-2.10E+00 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.87E-05; Z-score:-6.11E-01 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg13080927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:1.79E-16; Z-score:-3.28E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC6A17 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg18046311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.32E-10; Z-score:-2.70E+00 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:1.69E-05; Z-score:1.49E+00 | ||
|
Methylation in Case |
1.94E-01 (Median) | Methylation in Control | 1.48E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:3.92E-04; Z-score:1.52E+00 | ||
|
Methylation in Case |
1.44E-01 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:4.24E-04; Z-score:-5.52E-01 | ||
|
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 3.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg13048512) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.61E+00 | Statistic Test | p-value:8.32E-04; Z-score:1.49E+00 | ||
|
Methylation in Case |
2.48E-02 (Median) | Methylation in Control | 1.54E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.07E-03; Z-score:4.14E-01 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 4.35E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.79E-02; Z-score:4.04E-01 | ||
|
Methylation in Case |
5.11E-01 (Median) | Methylation in Control | 4.86E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg00961932) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:1.54E-02; Z-score:8.08E-01 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:1.28E-02; Z-score:7.52E-01 | ||
|
Methylation in Case |
4.07E-02 (Median) | Methylation in Control | 3.17E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.16E-04; Z-score:-1.36E+00 | ||
|
Methylation in Case |
7.02E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.22E-04; Z-score:-1.36E+00 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg19866406) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:8.25E-04; Z-score:-8.56E-01 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.49E-03; Z-score:-8.78E-01 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.64E-02; Z-score:-5.17E-01 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC6A17 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:3.17E-06; Z-score:-3.21E+00 | ||
|
Methylation in Case |
6.97E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.43E+00 | Statistic Test | p-value:6.54E-04; Z-score:5.94E+00 | ||
|
Methylation in Case |
3.48E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.70E+00 | Statistic Test | p-value:8.99E-03; Z-score:3.89E+00 | ||
|
Methylation in Case |
2.40E-01 (Median) | Methylation in Control | 1.41E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg15374686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:2.76E-02; Z-score:1.46E+00 | ||
|
Methylation in Case |
5.50E-01 (Median) | Methylation in Control | 4.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg05783233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:4.67E-02; Z-score:1.19E+00 | ||
|
Methylation in Case |
4.81E-01 (Median) | Methylation in Control | 3.94E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg17032646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:4.47E-02; Z-score:2.08E+00 | ||
|
Methylation in Case |
4.59E-01 (Median) | Methylation in Control | 3.87E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.38E+00 | Statistic Test | p-value:2.88E-02; Z-score:1.15E+00 | ||
|
Methylation in Case |
5.84E-02 (Median) | Methylation in Control | 4.23E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg03001176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:6.82E-03; Z-score:-3.29E+00 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:4.33E-02; Z-score:-1.31E+00 | ||
|
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC6A17 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:3.22E-03; Z-score:-2.53E+00 | ||
|
Methylation in Case |
6.25E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in panic disorder | [ 10 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:8.14E-01 | Statistic Test | p-value:1.33E-02; Z-score:4.76E-01 | ||
|
Methylation in Case |
-1.09E+00 (Median) | Methylation in Control | -1.34E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg12072789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:2.68E-05; Z-score:5.78E-01 | ||
|
Methylation in Case |
1.82E+00 (Median) | Methylation in Control | 1.58E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.05E-02; Z-score:6.21E-01 | ||
|
Methylation in Case |
3.42E+00 (Median) | Methylation in Control | 3.26E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in panic disorder | [ 10 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:3.88E-03; Z-score:5.70E-01 | ||
|
Methylation in Case |
2.26E+00 (Median) | Methylation in Control | 2.05E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:4.55E-04; Z-score:-1.06E+00 | ||
|
Methylation in Case |
1.99E-01 (Median) | Methylation in Control | 2.65E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg05949020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:2.63E-03; Z-score:6.10E-01 | ||
|
Methylation in Case |
8.70E-02 (Median) | Methylation in Control | 7.73E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:4.74E-03; Z-score:7.08E-01 | ||
|
Methylation in Case |
9.04E-02 (Median) | Methylation in Control | 7.64E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg04208466) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:8.94E-05; Z-score:-9.04E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.47E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
3'UTR (cg20678043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:4.53E-08; Z-score:-1.34E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
5'UTR (cg05348973) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.02E-02; Z-score:-1.87E-01 | ||
|
Methylation in Case |
3.13E-01 (Median) | Methylation in Control | 3.32E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
TSS1500 (cg23235497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.75E-02; Z-score:-1.39E-01 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
TSS200 (cg01202526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.08E-02; Z-score:4.56E-02 | ||
|
Methylation in Case |
2.82E-02 (Median) | Methylation in Control | 2.78E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg07587250) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.24E-02; Z-score:-2.09E-01 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in colon adenocarcinoma | [ 13 ] | |||
|
Location |
TSS1500 (cg20822693) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:2.02E-04; Z-score:-2.23E+00 | ||
|
Methylation in Case |
6.42E-01 (Median) | Methylation in Control | 7.51E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in colon adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg15027358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:8.55E-06; Z-score:-7.34E+00 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in colon adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg21090075) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:9.42E-06; Z-score:3.57E+00 | ||
|
Methylation in Case |
5.99E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in colon adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg24115232) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:6.38E-04; Z-score:5.75E-01 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS1500 (cg00910067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:1.84E-07; Z-score:1.88E+00 | ||
|
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 3.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg12392473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.43E+00 | Statistic Test | p-value:4.35E-19; Z-score:3.07E+00 | ||
|
Methylation in Case |
2.98E-01 (Median) | Methylation in Control | 8.69E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg13453520) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.51E+00 | Statistic Test | p-value:4.41E-16; Z-score:2.53E+00 | ||
|
Methylation in Case |
3.86E-01 (Median) | Methylation in Control | 2.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg26556895) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:1.12E-10; Z-score:1.08E+00 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 8.80E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg21123160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.53E+00 | Statistic Test | p-value:1.17E-07; Z-score:1.70E+00 | ||
|
Methylation in Case |
5.23E-01 (Median) | Methylation in Control | 3.42E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg02666489) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.42E-03; Z-score:-4.77E-01 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg25090499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.72E+00 | Statistic Test | p-value:6.41E-21; Z-score:3.45E+00 | ||
|
Methylation in Case |
3.20E-01 (Median) | Methylation in Control | 1.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg22544563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.90E+00 | Statistic Test | p-value:1.15E-09; Z-score:1.34E+00 | ||
|
Methylation in Case |
1.55E-01 (Median) | Methylation in Control | 8.18E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16405768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.13E-05; Z-score:1.05E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg27665580) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.25E-03; Z-score:-5.41E-01 | ||
|
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC6A17 in pancretic ductal adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16533977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.09E-02; Z-score:-2.87E-01 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
TSS1500 (cg15806304) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:1.82E-02; Z-score:2.17E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
TSS1500 (cg04152629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.44E+00 | Statistic Test | p-value:3.02E-02; Z-score:4.00E+00 | ||
|
Methylation in Case |
6.46E-02 (Median) | Methylation in Control | 4.47E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
TSS200 (cg24707219) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:1.18E-02; Z-score:-3.51E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 6.71E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg05255811) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:4.37E-04; Z-score:7.41E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 6.80E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg02881274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.76E+00 | Statistic Test | p-value:1.13E-02; Z-score:8.78E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 3.12E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg26411522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:1.43E-02; Z-score:-2.70E+00 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC6A17 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg13665414) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:4.89E-02; Z-score:1.30E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 6.29E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Glioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypermethylation of SLC6A17 in glioblastoma than that in healthy individual | ||||
Studied Phenotype |
Glioblastoma [ICD-11:2A00.00] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.011691749; Fold-change:0.285895092; Z-score:0.899267721 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC6A17 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.79E-18; Fold-change:0.518573345; Z-score:2.246156851 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypermethylation/moderate hypomethylation of SLC6A17 in gastric cancer than that in adjacent tissue/other disease section | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:4.94E-39; Fold-change:0.281747423; Z-score:38.43756811 | ||||
The Methylation Level of Disease Section Compare with the Other Disease Section |
p-value:.; Fold-change:.; Z-score:. | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
43 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1236 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1236 | miRNA Mature ID | miR-1236-5p | ||
|
miRNA Sequence |
UGAGUGACAGGGGAAAUGGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-128 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-128 | miRNA Mature ID | miR-128-3p | ||
|
miRNA Sequence |
UCACAGUGAACCGGUCUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-1321 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1321 | miRNA Mature ID | miR-1321 | ||
|
miRNA Sequence |
CAGGGAGGUGAAUGUGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-185 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-5p | ||
|
miRNA Sequence |
UGGAGAGAAAGGCAGUUCCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-216a directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-216a | miRNA Mature ID | miR-216a-3p | ||
|
miRNA Sequence |
UCACAGUGGUCUCUGGGAUUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-27a directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-27a | miRNA Mature ID | miR-27a-3p | ||
|
miRNA Sequence |
UUCACAGUGGCUAAGUUCCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-27b directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-27b | miRNA Mature ID | miR-27b-3p | ||
|
miRNA Sequence |
UUCACAGUGGCUAAGUUCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-3180 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3180 | miRNA Mature ID | miR-3180-5p | ||
|
miRNA Sequence |
CUUCCAGACGCUCCGCCCCACGUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-3681 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3681 | miRNA Mature ID | miR-3681-3p | ||
|
miRNA Sequence |
ACACAGUGCUUCAUCCACUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-3689d directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689d | miRNA Mature ID | miR-3689d | ||
|
miRNA Sequence |
GGGAGGUGUGAUCUCACACUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-4267 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4267 | miRNA Mature ID | miR-4267 | ||
|
miRNA Sequence |
UCCAGCUCGGUGGCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-4270 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4270 | miRNA Mature ID | miR-4270 | ||
|
miRNA Sequence |
UCAGGGAGUCAGGGGAGGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-4286 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4286 | miRNA Mature ID | miR-4286 | ||
|
miRNA Sequence |
ACCCCACUCCUGGUACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-4306 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4306 | miRNA Mature ID | miR-4306 | ||
|
miRNA Sequence |
UGGAGAGAAAGGCAGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-4433a directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4433a | miRNA Mature ID | miR-4433a-5p | ||
|
miRNA Sequence |
CGUCCCACCCCCCACUCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-4441 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4441 | miRNA Mature ID | miR-4441 | ||
|
miRNA Sequence |
ACAGGGAGGAGAUUGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-4510 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4510 | miRNA Mature ID | miR-4510 | ||
|
miRNA Sequence |
UGAGGGAGUAGGAUGUAUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon18 |
miR-4644 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4644 | miRNA Mature ID | miR-4644 | ||
|
miRNA Sequence |
UGGAGAGAGAAAAGAGACAGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-4697 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4697 | miRNA Mature ID | miR-4697-3p | ||
|
miRNA Sequence |
UGUCAGUGACUCCUGCCCCUUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon20 |
miR-4739 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4739 | miRNA Mature ID | miR-4739 | ||
|
miRNA Sequence |
AAGGGAGGAGGAGCGGAGGGGCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-4756 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4756 | miRNA Mature ID | miR-4756-5p | ||
|
miRNA Sequence |
CAGGGAGGCGCUCACUCUCUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon22 |
miR-4765 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4765 | miRNA Mature ID | miR-4765 | ||
|
miRNA Sequence |
UGAGUGAUUGAUAGCUAUGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon23 |
miR-513a directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-513a | miRNA Mature ID | miR-513a-5p | ||
|
miRNA Sequence |
UUCACAGGGAGGUGUCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon24 |
miR-6127 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6127 | miRNA Mature ID | miR-6127 | ||
|
miRNA Sequence |
UGAGGGAGUGGGUGGGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon25 |
miR-6129 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6129 | miRNA Mature ID | miR-6129 | ||
|
miRNA Sequence |
UGAGGGAGUUGGGUGUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon26 |
miR-6130 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6130 | miRNA Mature ID | miR-6130 | ||
|
miRNA Sequence |
UGAGGGAGUGGAUUGUAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon27 |
miR-6133 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6133 | miRNA Mature ID | miR-6133 | ||
|
miRNA Sequence |
UGAGGGAGGAGGUUGGGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon28 |
miR-627 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-627 | miRNA Mature ID | miR-627-3p | ||
|
miRNA Sequence |
UCUUUUCUUUGAGACUCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon29 |
miR-6512 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6512 | miRNA Mature ID | miR-6512-3p | ||
|
miRNA Sequence |
UUCCAGCCCUUCUAAUGGUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon30 |
miR-6720 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6720 | miRNA Mature ID | miR-6720-5p | ||
|
miRNA Sequence |
UUCCAGCCCUGGUAGGCGCCGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon31 |
miR-6731 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6731 | miRNA Mature ID | miR-6731-5p | ||
|
miRNA Sequence |
UGGGAGAGCAGGGUAUUGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon32 |
miR-6754 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6754 | miRNA Mature ID | miR-6754-5p | ||
|
miRNA Sequence |
CCAGGGAGGCUGGUUUGGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon33 |
miR-6758 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6758 | miRNA Mature ID | miR-6758-5p | ||
|
miRNA Sequence |
UAGAGAGGGGAAGGAUGUGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon34 |
miR-6760 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6760 | miRNA Mature ID | miR-6760-5p | ||
|
miRNA Sequence |
CAGGGAGAAGGUGGAAGUGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon35 |
miR-6793 directly targets SLC6A17 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6793 | miRNA Mature ID | miR-6793-3p | ||
|
miRNA Sequence |
UCCCCAACCCCUGCCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon36 |
miR-6799 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6799 | miRNA Mature ID | miR-6799-5p | ||
|
miRNA Sequence |
GGGGAGGUGUGCAGGGCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon37 |
miR-6851 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6851 | miRNA Mature ID | miR-6851-5p | ||
|
miRNA Sequence |
AGGAGGUGGUACUAGGGGCCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon38 |
miR-6856 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6856 | miRNA Mature ID | miR-6856-5p | ||
|
miRNA Sequence |
AAGAGAGGAGCAGUGGUGCUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon39 |
miR-6873 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6873 | miRNA Mature ID | miR-6873-5p | ||
|
miRNA Sequence |
CAGAGGGAAUACAGAGGGCAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon40 |
miR-7151 directly targets SLC6A17 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-5p | ||
|
miRNA Sequence |
GAUCCAUCUCUGCCUGUAUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon41 |
miR-7151 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-3p | ||
|
miRNA Sequence |
CUACAGGCUGGAAUGGGCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon42 |
miR-7854 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7854 | miRNA Mature ID | miR-7854-3p | ||
|
miRNA Sequence |
UGAGGUGACCGCAGAUGGGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon43 |
miR-8085 directly targets SLC6A17 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8085 | miRNA Mature ID | miR-8085 | ||
|
miRNA Sequence |
UGGGAGAGAGGACUGUGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.