General Information of Drug Transporter (DT)
DT ID DTD0449 Transporter Info
Gene Name SLC6A17
Transporter Name Sodium-dependent neurotransmitter transporter
Gene ID
388662
UniProt ID
Q9H1V8
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:1.15E-08; Z-score:-1.80E+00

Methylation in Case

5.11E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg05348973)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:4.50E-08; Z-score:-1.71E+00

Methylation in Case

7.45E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg05783233)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.55E+00 Statistic Test p-value:4.76E-08; Z-score:-1.64E+00

Methylation in Case

3.58E-01 (Median) Methylation in Control 5.55E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:5.13E-08; Z-score:1.65E+00

Methylation in Case

6.39E-01 (Median) Methylation in Control 4.42E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg13048512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:4.82E-07; Z-score:1.13E+00

Methylation in Case

7.07E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.15E-06; Z-score:-1.27E+00

Methylation in Case

7.72E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg03001176)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:2.48E-04; Z-score:-6.33E-01

Methylation in Case

3.38E-01 (Median) Methylation in Control 4.47E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg04208466)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:6.13E-04; Z-score:-5.26E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg07587250)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.43E-03; Z-score:-6.04E-01

Methylation in Case

9.16E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg07598082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:4.45E-03; Z-score:9.73E-01

Methylation in Case

7.26E-01 (Median) Methylation in Control 6.04E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg11828251)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.54E-02; Z-score:-3.38E-01

Methylation in Case

1.52E-01 (Median) Methylation in Control 1.65E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg12072789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.66E-02; Z-score:3.55E-01

Methylation in Case

8.82E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A17 in atypical teratoid rhabdoid tumor [ 1 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:4.39E-10; Z-score:-2.01E+00

Methylation in Case

4.36E-01 (Median) Methylation in Control 6.69E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

         18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

5'UTR (cg05348973)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.81E+00 Statistic Test p-value:1.14E-05; Z-score:-3.58E+00

Methylation in Case

8.91E-02 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.87E+00 Statistic Test p-value:3.31E-05; Z-score:7.06E+00

Methylation in Case

2.46E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.12E+00 Statistic Test p-value:3.95E-05; Z-score:8.12E+00

Methylation in Case

2.21E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:4.81E-04; Z-score:4.05E+00

Methylation in Case

4.87E-01 (Median) Methylation in Control 3.50E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

5'UTR (cg13048512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.11E+00 Statistic Test p-value:1.33E-03; Z-score:2.46E+00

Methylation in Case

3.57E-02 (Median) Methylation in Control 1.70E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

5'UTR (cg05783233)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:1.07E-02; Z-score:-2.53E+00

Methylation in Case

2.62E-01 (Median) Methylation in Control 3.53E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

TSS1500 (cg00961932)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.74E+00 Statistic Test p-value:1.08E-07; Z-score:-6.93E+00

Methylation in Case

8.90E-02 (Median) Methylation in Control 2.44E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

TSS1500 (cg17032646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.64E+00 Statistic Test p-value:1.15E-06; Z-score:7.83E+00

Methylation in Case

4.37E-01 (Median) Methylation in Control 2.66E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

TSS1500 (cg10761097)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:1.29E-06; Z-score:-1.35E+01

Methylation in Case

6.75E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

TSS1500 (cg23235497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:7.51E-03; Z-score:3.57E+00

Methylation in Case

3.82E-01 (Median) Methylation in Control 2.99E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

Body (cg11828251)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:1.36E-06; Z-score:-4.57E+00

Methylation in Case

5.14E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

Body (cg12072789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.57E+00 Statistic Test p-value:2.08E-06; Z-score:-6.29E+00

Methylation in Case

4.15E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

Body (cg19866406)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:2.89E-06; Z-score:-1.68E+01

Methylation in Case

5.80E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

Body (cg03001176)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:5.70E-06; Z-score:-7.99E+00

Methylation in Case

5.55E-01 (Median) Methylation in Control 7.30E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

Body (cg04208466)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.64E-05; Z-score:-1.25E+01

Methylation in Case

7.54E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

Body (cg07587250)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.57E+00 Statistic Test p-value:8.05E-05; Z-score:-3.82E+00

Methylation in Case

4.10E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

Body (cg07598082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:4.03E-04; Z-score:-3.43E+00

Methylation in Case

8.23E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A17 in bladder cancer [ 2 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.58E+00 Statistic Test p-value:7.13E-08; Z-score:-1.04E+01

Methylation in Case

4.44E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.60E+00 Statistic Test p-value:1.47E-11; Z-score:2.41E+00

Methylation in Case

1.58E-01 (Median) Methylation in Control 9.87E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

5'UTR (cg13048512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:8.43E-06; Z-score:9.76E-01

Methylation in Case

3.33E-02 (Median) Methylation in Control 2.30E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:5.91E-04; Z-score:1.12E+00

Methylation in Case

5.02E-01 (Median) Methylation in Control 4.32E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

5'UTR (cg05348973)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:6.80E-03; Z-score:-9.93E-01

Methylation in Case

2.23E-01 (Median) Methylation in Control 3.23E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.40E-02; Z-score:4.69E-01

Methylation in Case

3.45E-01 (Median) Methylation in Control 3.10E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

TSS1500 (cg00961932)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:2.31E-13; Z-score:-1.99E+00

Methylation in Case

1.52E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

TSS1500 (cg10761097)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.28E-12; Z-score:-3.42E+00

Methylation in Case

7.43E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

TSS1500 (cg23235497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:4.42E-08; Z-score:1.11E+00

Methylation in Case

4.14E-01 (Median) Methylation in Control 3.42E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

TSS1500 (cg17032646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:5.04E-05; Z-score:7.85E-01

Methylation in Case

4.45E-01 (Median) Methylation in Control 4.09E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

TSS200 (cg01202526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.07E+00 Statistic Test p-value:4.03E-06; Z-score:1.26E+00

Methylation in Case

4.14E-02 (Median) Methylation in Control 2.00E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

Body (cg07587250)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:1.20E-09; Z-score:-1.96E+00

Methylation in Case

5.15E-01 (Median) Methylation in Control 6.85E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

Body (cg03001176)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.99E-07; Z-score:-1.34E+00

Methylation in Case

7.16E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

Body (cg12072789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.57E-07; Z-score:-1.87E+00

Methylation in Case

5.84E-01 (Median) Methylation in Control 6.65E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

Body (cg11828251)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.45E-07; Z-score:-1.27E+00

Methylation in Case

7.41E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

Body (cg04208466)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.07E-05; Z-score:-9.36E-01

Methylation in Case

8.34E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A17 in breast cancer [ 3 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:1.49E-13; Z-score:-2.67E+00

Methylation in Case

6.16E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.64E+00 Statistic Test p-value:1.23E-05; Z-score:1.46E+00

Methylation in Case

8.51E-02 (Median) Methylation in Control 5.18E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.75E+00 Statistic Test p-value:1.43E-05; Z-score:2.60E+00

Methylation in Case

8.34E-02 (Median) Methylation in Control 4.76E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:1.10E-03; Z-score:3.00E+00

Methylation in Case

5.27E-01 (Median) Methylation in Control 4.26E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg13048512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:3.98E-03; Z-score:5.99E-01

Methylation in Case

1.92E-02 (Median) Methylation in Control 1.75E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg00961932)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.71E+00 Statistic Test p-value:3.98E-02; Z-score:-2.09E+00

Methylation in Case

1.74E-01 (Median) Methylation in Control 2.98E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.10E+00 Statistic Test p-value:1.17E-19; Z-score:4.82E+00

Methylation in Case

5.87E-01 (Median) Methylation in Control 2.80E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

5'UTR (cg13048512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+01 Statistic Test p-value:1.59E-19; Z-score:1.17E+01

Methylation in Case

3.49E-01 (Median) Methylation in Control 3.11E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.70E+00 Statistic Test p-value:2.83E-09; Z-score:2.29E+00

Methylation in Case

5.83E-01 (Median) Methylation in Control 3.43E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:5.19E-08; Z-score:1.98E+00

Methylation in Case

8.01E-01 (Median) Methylation in Control 6.77E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

5'UTR (cg05348973)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:4.67E-04; Z-score:-1.67E+00

Methylation in Case

2.06E-01 (Median) Methylation in Control 2.81E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

5'UTR (cg05783233)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.05E-03; Z-score:-1.50E+00

Methylation in Case

5.17E-01 (Median) Methylation in Control 5.66E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

TSS1500 (cg10761097)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.13E-05; Z-score:-9.10E-01

Methylation in Case

8.92E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

TSS1500 (cg17032646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.06E-04; Z-score:9.49E-01

Methylation in Case

6.29E-01 (Median) Methylation in Control 5.80E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

TSS200 (cg01202526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.74E+00 Statistic Test p-value:9.73E-13; Z-score:9.35E+00

Methylation in Case

1.95E-01 (Median) Methylation in Control 5.21E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

Body (cg12072789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:3.90E-14; Z-score:-3.42E+00

Methylation in Case

6.65E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

Body (cg03001176)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:7.95E-07; Z-score:-1.54E+00

Methylation in Case

8.09E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

Body (cg07598082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.44E-06; Z-score:-3.72E+00

Methylation in Case

9.33E-01 (Median) Methylation in Control 9.57E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

Body (cg19866406)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:5.93E-06; Z-score:-2.77E+00

Methylation in Case

8.27E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

Body (cg11828251)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.49E-04; Z-score:-1.42E+00

Methylation in Case

8.68E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

Body (cg04208466)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.10E-03; Z-score:-6.17E-01

Methylation in Case

9.26E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A17 in colorectal cancer [ 5 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:1.94E-12; Z-score:-3.44E+00

Methylation in Case

7.32E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Moderate hypermethylation of SLC6A17 in colorectal cancer than that in healthy individual

Studied Phenotype

Colorectal cancer [ICD-11:2B91]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.02E-20; Fold-change:0.241366751; Z-score:2.59949617
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Depression

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in depression [ 6 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.95E-02; Z-score:4.68E-01

Methylation in Case

3.56E-01 (Median) Methylation in Control 3.31E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in depression [ 6 ]

Location

Body (cg07598082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.88E-02; Z-score:-5.21E-01

Methylation in Case

9.23E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         19 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg13048512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:1.96E-04; Z-score:2.17E-01

Methylation in Case

2.99E-02 (Median) Methylation in Control 2.72E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:6.10E-04; Z-score:2.63E-01

Methylation in Case

1.21E-01 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.10E-02; Z-score:2.35E-01

Methylation in Case

1.66E-01 (Median) Methylation in Control 1.60E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg05783233)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:3.84E-02; Z-score:-1.18E+00

Methylation in Case

2.74E-01 (Median) Methylation in Control 3.22E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg09312996)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:5.62E-10; Z-score:-1.86E+00

Methylation in Case

5.65E-01 (Median) Methylation in Control 6.26E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg10761097)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.05E-05; Z-score:-9.94E-01

Methylation in Case

8.27E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg00961932)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:2.09E-03; Z-score:-6.77E-01

Methylation in Case

1.41E-01 (Median) Methylation in Control 1.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg23235497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.20E-02; Z-score:-7.42E-01

Methylation in Case

3.11E-01 (Median) Methylation in Control 3.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

TSS200 (cg02244028)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:7.11E-12; Z-score:-4.03E+00

Methylation in Case

6.46E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

TSS200 (cg01202526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:4.40E-03; Z-score:1.29E-01

Methylation in Case

4.10E-02 (Median) Methylation in Control 3.88E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

Body (cg16397021)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.84E+00 Statistic Test p-value:9.14E-19; Z-score:-6.45E+00

Methylation in Case

4.45E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

Body (cg11842953)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.64E+00 Statistic Test p-value:1.53E-15; Z-score:-8.59E+00

Methylation in Case

5.58E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

Body (cg06622573)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:1.21E-11; Z-score:-4.56E+00

Methylation in Case

5.12E-01 (Median) Methylation in Control 6.83E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

Body (cg09050160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.56E+00 Statistic Test p-value:8.76E-10; Z-score:-1.92E+00

Methylation in Case

2.78E-01 (Median) Methylation in Control 4.32E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

Body (cg04208466)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.42E-09; Z-score:-2.29E+00

Methylation in Case

7.75E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

Body (cg07598082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.81E-06; Z-score:-2.10E+00

Methylation in Case

9.15E-01 (Median) Methylation in Control 9.54E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

Body (cg03001176)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.87E-05; Z-score:-6.11E-01

Methylation in Case

6.94E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

3'UTR (cg13080927)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.44E+00 Statistic Test p-value:1.79E-16; Z-score:-3.28E+00

Methylation in Case

4.37E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC6A17 in hepatocellular carcinoma [ 7 ]

Location

3'UTR (cg18046311)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.32E-10; Z-score:-2.70E+00

Methylation in Case

7.63E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:1.69E-05; Z-score:1.49E+00

Methylation in Case

1.94E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:3.92E-04; Z-score:1.52E+00

Methylation in Case

1.44E-01 (Median) Methylation in Control 1.08E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

5'UTR (cg05348973)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:4.24E-04; Z-score:-5.52E-01

Methylation in Case

2.90E-01 (Median) Methylation in Control 3.27E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

5'UTR (cg13048512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.61E+00 Statistic Test p-value:8.32E-04; Z-score:1.49E+00

Methylation in Case

2.48E-02 (Median) Methylation in Control 1.54E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.07E-03; Z-score:4.14E-01

Methylation in Case

4.63E-01 (Median) Methylation in Control 4.35E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

5'UTR (cg05783233)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.79E-02; Z-score:4.04E-01

Methylation in Case

5.11E-01 (Median) Methylation in Control 4.86E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

TSS1500 (cg00961932)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.54E-02; Z-score:8.08E-01

Methylation in Case

2.13E-01 (Median) Methylation in Control 1.74E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

TSS200 (cg01202526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:1.28E-02; Z-score:7.52E-01

Methylation in Case

4.07E-02 (Median) Methylation in Control 3.17E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

Body (cg12072789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.16E-04; Z-score:-1.36E+00

Methylation in Case

7.02E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

Body (cg03001176)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.22E-04; Z-score:-1.36E+00

Methylation in Case

7.04E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

Body (cg19866406)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.25E-04; Z-score:-8.56E-01

Methylation in Case

8.79E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

Body (cg07587250)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.49E-03; Z-score:-8.78E-01

Methylation in Case

8.17E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

Body (cg04208466)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.64E-02; Z-score:-5.17E-01

Methylation in Case

9.23E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC6A17 in HIV infection [ 8 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:3.17E-06; Z-score:-3.21E+00

Methylation in Case

6.97E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.43E+00 Statistic Test p-value:6.54E-04; Z-score:5.94E+00

Methylation in Case

3.48E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.70E+00 Statistic Test p-value:8.99E-03; Z-score:3.89E+00

Methylation in Case

2.40E-01 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:2.76E-02; Z-score:1.46E+00

Methylation in Case

5.50E-01 (Median) Methylation in Control 4.34E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg05783233)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:4.67E-02; Z-score:1.19E+00

Methylation in Case

4.81E-01 (Median) Methylation in Control 3.94E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg17032646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:4.47E-02; Z-score:2.08E+00

Methylation in Case

4.59E-01 (Median) Methylation in Control 3.87E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

TSS200 (cg01202526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:2.88E-02; Z-score:1.15E+00

Methylation in Case

5.84E-02 (Median) Methylation in Control 4.23E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

Body (cg03001176)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:6.82E-03; Z-score:-3.29E+00

Methylation in Case

6.90E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

Body (cg07587250)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.33E-02; Z-score:-1.31E+00

Methylation in Case

7.19E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A17 in lung adenocarcinoma [ 9 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:3.22E-03; Z-score:-2.53E+00

Methylation in Case

6.25E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in panic disorder [ 10 ]

Location

5'UTR (cg05348973)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:8.14E-01 Statistic Test p-value:1.33E-02; Z-score:4.76E-01

Methylation in Case

-1.09E+00 (Median) Methylation in Control -1.34E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in panic disorder [ 10 ]

Location

Body (cg12072789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:2.68E-05; Z-score:5.78E-01

Methylation in Case

1.82E+00 (Median) Methylation in Control 1.58E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in panic disorder [ 10 ]

Location

Body (cg04208466)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.05E-02; Z-score:6.21E-01

Methylation in Case

3.42E+00 (Median) Methylation in Control 3.26E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in panic disorder [ 10 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:3.88E-03; Z-score:5.70E-01

Methylation in Case

2.26E+00 (Median) Methylation in Control 2.05E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in papillary thyroid cancer [ 11 ]

Location

5'UTR (cg05348973)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:4.55E-04; Z-score:-1.06E+00

Methylation in Case

1.99E-01 (Median) Methylation in Control 2.65E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in papillary thyroid cancer [ 11 ]

Location

5'UTR (cg05949020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:2.63E-03; Z-score:6.10E-01

Methylation in Case

8.70E-02 (Median) Methylation in Control 7.73E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in papillary thyroid cancer [ 11 ]

Location

5'UTR (cg01791587)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:4.74E-03; Z-score:7.08E-01

Methylation in Case

9.04E-02 (Median) Methylation in Control 7.64E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in papillary thyroid cancer [ 11 ]

Location

Body (cg04208466)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:8.94E-05; Z-score:-9.04E-01

Methylation in Case

9.35E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in papillary thyroid cancer [ 11 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.53E-08; Z-score:-1.34E+00

Methylation in Case

7.34E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in systemic lupus erythematosus [ 12 ]

Location

5'UTR (cg05348973)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.02E-02; Z-score:-1.87E-01

Methylation in Case

3.13E-01 (Median) Methylation in Control 3.32E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in systemic lupus erythematosus [ 12 ]

Location

TSS1500 (cg23235497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.75E-02; Z-score:-1.39E-01

Methylation in Case

4.63E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in systemic lupus erythematosus [ 12 ]

Location

TSS200 (cg01202526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.08E-02; Z-score:4.56E-02

Methylation in Case

2.82E-02 (Median) Methylation in Control 2.78E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in systemic lupus erythematosus [ 12 ]

Location

Body (cg07587250)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.24E-02; Z-score:-2.09E-01

Methylation in Case

8.26E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Colon cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in colon adenocarcinoma [ 13 ]

Location

TSS1500 (cg20822693)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:2.02E-04; Z-score:-2.23E+00

Methylation in Case

6.42E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in colon adenocarcinoma [ 13 ]

Location

Body (cg15027358)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:8.55E-06; Z-score:-7.34E+00

Methylation in Case

7.29E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in colon adenocarcinoma [ 13 ]

Location

Body (cg21090075)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:9.42E-06; Z-score:3.57E+00

Methylation in Case

5.99E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in colon adenocarcinoma [ 13 ]

Location

Body (cg24115232)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:6.38E-04; Z-score:5.75E-01

Methylation in Case

8.05E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

TSS1500 (cg00910067)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:1.84E-07; Z-score:1.88E+00

Methylation in Case

3.77E-01 (Median) Methylation in Control 3.15E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

TSS200 (cg12392473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.43E+00 Statistic Test p-value:4.35E-19; Z-score:3.07E+00

Methylation in Case

2.98E-01 (Median) Methylation in Control 8.69E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

TSS200 (cg13453520)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.51E+00 Statistic Test p-value:4.41E-16; Z-score:2.53E+00

Methylation in Case

3.86E-01 (Median) Methylation in Control 2.55E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

TSS200 (cg26556895)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:1.12E-10; Z-score:1.08E+00

Methylation in Case

1.14E-01 (Median) Methylation in Control 8.80E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

TSS200 (cg21123160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.53E+00 Statistic Test p-value:1.17E-07; Z-score:1.70E+00

Methylation in Case

5.23E-01 (Median) Methylation in Control 3.42E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

TSS200 (cg02666489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.42E-03; Z-score:-4.77E-01

Methylation in Case

7.01E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

Body (cg25090499)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.72E+00 Statistic Test p-value:6.41E-21; Z-score:3.45E+00

Methylation in Case

3.20E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

Body (cg22544563)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.90E+00 Statistic Test p-value:1.15E-09; Z-score:1.34E+00

Methylation in Case

1.55E-01 (Median) Methylation in Control 8.18E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

Body (cg16405768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.13E-05; Z-score:1.05E+00

Methylation in Case

8.07E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

Body (cg27665580)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.25E-03; Z-score:-5.41E-01

Methylation in Case

7.46E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC6A17 in pancretic ductal adenocarcinoma [ 14 ]

Location

Body (cg16533977)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.09E-02; Z-score:-2.87E-01

Methylation in Case

9.23E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC6A17 in prostate cancer [ 15 ]

Location

TSS1500 (cg15806304)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:1.82E-02; Z-score:2.17E+00

Methylation in Case

7.98E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC6A17 in prostate cancer [ 15 ]

Location

TSS1500 (cg04152629)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:3.02E-02; Z-score:4.00E+00

Methylation in Case

6.46E-02 (Median) Methylation in Control 4.47E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC6A17 in prostate cancer [ 15 ]

Location

TSS200 (cg24707219)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:1.18E-02; Z-score:-3.51E+00

Methylation in Case

4.93E-01 (Median) Methylation in Control 6.71E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC6A17 in prostate cancer [ 15 ]

Location

Body (cg05255811)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:4.37E-04; Z-score:7.41E+00

Methylation in Case

8.49E-01 (Median) Methylation in Control 6.80E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC6A17 in prostate cancer [ 15 ]

Location

Body (cg02881274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.76E+00 Statistic Test p-value:1.13E-02; Z-score:8.78E+00

Methylation in Case

5.49E-01 (Median) Methylation in Control 3.12E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC6A17 in prostate cancer [ 15 ]

Location

Body (cg26411522)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:1.43E-02; Z-score:-2.70E+00

Methylation in Case

4.77E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC6A17 in prostate cancer [ 15 ]

Location

Body (cg13665414)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:4.89E-02; Z-score:1.30E+00

Methylation in Case

7.32E-01 (Median) Methylation in Control 6.29E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Glioblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC6A17 in glioblastoma than that in healthy individual

Studied Phenotype

Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.011691749; Fold-change:0.285895092; Z-score:0.899267721
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC6A17 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.79E-18; Fold-change:0.518573345; Z-score:2.246156851
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Gastric cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation/moderate hypomethylation of SLC6A17 in gastric cancer than that in adjacent tissue/other disease section

Studied Phenotype

Gastric cancer [ICD-11:2B72]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:4.94E-39; Fold-change:0.281747423; Z-score:38.43756811

The Methylation Level of Disease Section Compare with the Other Disease Section

p-value:.; Fold-change:.; Z-score:.
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

microRNA

  Unclear Phenotype

         43 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1236 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1236 miRNA Mature ID miR-1236-5p

miRNA Sequence

UGAGUGACAGGGGAAAUGGGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-128 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-128 miRNA Mature ID miR-128-3p

miRNA Sequence

UCACAGUGAACCGGUCUCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1321 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1321 miRNA Mature ID miR-1321

miRNA Sequence

CAGGGAGGUGAAUGUGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-185 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-185 miRNA Mature ID miR-185-5p

miRNA Sequence

UGGAGAGAAAGGCAGUUCCUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-216a directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-216a miRNA Mature ID miR-216a-3p

miRNA Sequence

UCACAGUGGUCUCUGGGAUUAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-27a directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-27a miRNA Mature ID miR-27a-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-27b directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-27b miRNA Mature ID miR-27b-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-3180 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3180 miRNA Mature ID miR-3180-5p

miRNA Sequence

CUUCCAGACGCUCCGCCCCACGUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-3681 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3681 miRNA Mature ID miR-3681-3p

miRNA Sequence

ACACAGUGCUUCAUCCACUACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-3689d directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-4267 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4267 miRNA Mature ID miR-4267

miRNA Sequence

UCCAGCUCGGUGGCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-4270 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4270 miRNA Mature ID miR-4270

miRNA Sequence

UCAGGGAGUCAGGGGAGGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-4286 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4286 miRNA Mature ID miR-4286

miRNA Sequence

ACCCCACUCCUGGUACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-4306 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4306 miRNA Mature ID miR-4306

miRNA Sequence

UGGAGAGAAAGGCAGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-4433a directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4433a miRNA Mature ID miR-4433a-5p

miRNA Sequence

CGUCCCACCCCCCACUCCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-4441 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4441 miRNA Mature ID miR-4441

miRNA Sequence

ACAGGGAGGAGAUUGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-4510 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4510 miRNA Mature ID miR-4510

miRNA Sequence

UGAGGGAGUAGGAUGUAUGGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-4644 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4644 miRNA Mature ID miR-4644

miRNA Sequence

UGGAGAGAGAAAAGAGACAGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-4697 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4697 miRNA Mature ID miR-4697-3p

miRNA Sequence

UGUCAGUGACUCCUGCCCCUUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-4739 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4739 miRNA Mature ID miR-4739

miRNA Sequence

AAGGGAGGAGGAGCGGAGGGGCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-4756 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4756 miRNA Mature ID miR-4756-5p

miRNA Sequence

CAGGGAGGCGCUCACUCUCUGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-4765 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4765 miRNA Mature ID miR-4765

miRNA Sequence

UGAGUGAUUGAUAGCUAUGUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-513a directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-513a miRNA Mature ID miR-513a-5p

miRNA Sequence

UUCACAGGGAGGUGUCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-6127 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6127 miRNA Mature ID miR-6127

miRNA Sequence

UGAGGGAGUGGGUGGGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-6129 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6129 miRNA Mature ID miR-6129

miRNA Sequence

UGAGGGAGUUGGGUGUAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-6130 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6130 miRNA Mature ID miR-6130

miRNA Sequence

UGAGGGAGUGGAUUGUAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-6133 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6133 miRNA Mature ID miR-6133

miRNA Sequence

UGAGGGAGGAGGUUGGGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-627 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-627 miRNA Mature ID miR-627-3p

miRNA Sequence

UCUUUUCUUUGAGACUCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-6512 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-6720 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-6731 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6731 miRNA Mature ID miR-6731-5p

miRNA Sequence

UGGGAGAGCAGGGUAUUGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-6754 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6754 miRNA Mature ID miR-6754-5p

miRNA Sequence

CCAGGGAGGCUGGUUUGGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-6758 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6758 miRNA Mature ID miR-6758-5p

miRNA Sequence

UAGAGAGGGGAAGGAUGUGAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-6760 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6760 miRNA Mature ID miR-6760-5p

miRNA Sequence

CAGGGAGAAGGUGGAAGUGCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-6793 directly targets SLC6A17 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6793 miRNA Mature ID miR-6793-3p

miRNA Sequence

UCCCCAACCCCUGCCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-6799 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6799 miRNA Mature ID miR-6799-5p

miRNA Sequence

GGGGAGGUGUGCAGGGCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-6851 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-6856 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6856 miRNA Mature ID miR-6856-5p

miRNA Sequence

AAGAGAGGAGCAGUGGUGCUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-6873 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6873 miRNA Mature ID miR-6873-5p

miRNA Sequence

CAGAGGGAAUACAGAGGGCAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-7151 directly targets SLC6A17 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7151 miRNA Mature ID miR-7151-5p

miRNA Sequence

GAUCCAUCUCUGCCUGUAUUGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-7151 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-7854 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7854 miRNA Mature ID miR-7854-3p

miRNA Sequence

UGAGGUGACCGCAGAUGGGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-8085 directly targets SLC6A17 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8085 miRNA Mature ID miR-8085

miRNA Sequence

UGGGAGAGAGGACUGUGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
15 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
17 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
18 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.