Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0428 Transporter Info
Gene Name	SLC5A8
Transporter Name	Sodium-coupled monocarboxylate transporter 1
Gene ID	160728
UniProt ID	Q8N695

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC5A8 in colon cancer			[ 1 ]
Location	Exon 1
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation ofSLC5A8	Experiment Method	RT-qPCR
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Frequency	38 (59%) out of the 64 studied tumor sample
Experimental Material	Patient tissue samples
Additional Notes	SLC5A8 had increased methylation and decreased expression in colon cancer.
Lung cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC5A8 in lung cancer			[ 2 ]
Location	Promoter (-278 to +148 bp)
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation ofSLC5A8	Experiment Method	RT-qPCR
Studied Phenotype	Lung cancer[ ICD-11:2C25]
Frequency	14 (61%) out of the 23 studied tumor sample
Experimental Material	Patient tissue samples
Additional Notes	DNA methylation in the promoter region of SLC5A8 and its association with gene silencing of SLC5A8 in lung cancer cell lines and tumor tissues.
Lung adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC5A8 in lung adenocarcinoma			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite pyrosequencing
Related Molecular Changes	Down regulation ofSLC5A8	Experiment Method	Immunohistochemical staining
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Additional Notes	The methylation level of exon 1 in the SLC5A8 gene was significantly associated with poor prognosis in cases of node-negative stage I and II lung AD.
Epigenetic Phenomenon2	Methylation of SLC5A8 in lung adenocarcinoma			[ 15 ]
Location	TSS200 (cg26490054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.71E+00	Statistic Test	p-value:1.24E-02; Z-score:3.76E+00
Methylation in Case	1.56E-01 (Median)	Methylation in Control	9.09E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in lung adenocarcinoma			[ 15 ]
Location	TSS200 (cg13433302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.42E+00	Statistic Test	p-value:2.05E-02; Z-score:2.85E+00
Methylation in Case	2.47E-01 (Median)	Methylation in Control	1.73E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in lung adenocarcinoma			[ 15 ]
Location	TSS200 (cg12135976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:2.24E-02; Z-score:1.40E+00
Methylation in Case	3.21E-01 (Median)	Methylation in Control	2.47E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in lung adenocarcinoma			[ 15 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:9.70E-04; Z-score:2.22E+00
Methylation in Case	4.12E-01 (Median)	Methylation in Control	3.27E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in lung adenocarcinoma			[ 15 ]
Location	1stExon (cg14730445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.16E+00	Statistic Test	p-value:2.40E-03; Z-score:3.30E+00
Methylation in Case	2.96E-01 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in lung adenocarcinoma			[ 15 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.46E+00	Statistic Test	p-value:5.41E-03; Z-score:1.71E+00
Methylation in Case	3.71E-01 (Median)	Methylation in Control	2.54E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Bladder cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	TSS1500 (cg05193162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.74E+00	Statistic Test	p-value:1.19E-08; Z-score:-7.46E+00
Methylation in Case	4.21E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	TSS1500 (cg27645544)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.16E+00	Statistic Test	p-value:1.43E-07; Z-score:-6.26E+00
Methylation in Case	3.25E-01 (Median)	Methylation in Control	7.01E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	TSS1500 (cg26622895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:1.25E-05; Z-score:-3.14E+00
Methylation in Case	5.49E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	TSS200 (cg13433302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:1.60E-03; Z-score:3.41E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	TSS200 (cg12135976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:2.39E-02; Z-score:2.78E+00
Methylation in Case	2.20E-01 (Median)	Methylation in Control	1.52E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	TSS200 (cg26490054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:2.61E-02; Z-score:7.21E-01
Methylation in Case	7.29E-02 (Median)	Methylation in Control	6.17E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	1stExon (cg14730445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:5.28E+00	Statistic Test	p-value:2.13E-08; Z-score:1.11E+01
Methylation in Case	5.17E-01 (Median)	Methylation in Control	9.79E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.70E+00	Statistic Test	p-value:2.20E-08; Z-score:1.40E+01
Methylation in Case	4.98E-01 (Median)	Methylation in Control	1.84E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.43E+00	Statistic Test	p-value:1.92E-02; Z-score:3.09E+00
Methylation in Case	3.20E-01 (Median)	Methylation in Control	2.25E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	Body (cg16287284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.40E+00	Statistic Test	p-value:1.69E-11; Z-score:-1.22E+01
Methylation in Case	2.46E-01 (Median)	Methylation in Control	5.89E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	Body (cg18813959)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.01E-03; Z-score:-4.57E+00
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	Body (cg16005224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:1.61E-02; Z-score:1.67E+00
Methylation in Case	4.41E-01 (Median)	Methylation in Control	3.61E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC5A8 in bladder cancer			[ 4 ]
Location	3'UTR (cg06162589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.35E+00	Statistic Test	p-value:1.31E-08; Z-score:-9.87E+00
Methylation in Case	1.95E-01 (Median)	Methylation in Control	4.58E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	TSS1500 (cg05193162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:2.07E-03; Z-score:-4.97E-01
Methylation in Case	6.85E-01 (Median)	Methylation in Control	7.49E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	TSS1500 (cg27645544)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.60E-02; Z-score:-4.96E-01
Methylation in Case	6.05E-01 (Median)	Methylation in Control	6.42E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	TSS200 (cg26490054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:6.63E-06; Z-score:8.20E-01
Methylation in Case	8.24E-02 (Median)	Methylation in Control	6.04E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	TSS200 (cg13433302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:4.44E-04; Z-score:3.96E-01
Methylation in Case	1.52E-01 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	1stExon (cg14730445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.09E+00	Statistic Test	p-value:1.37E-07; Z-score:1.66E+00
Methylation in Case	1.60E-01 (Median)	Methylation in Control	7.64E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.38E+00	Statistic Test	p-value:2.10E-07; Z-score:1.66E+00
Methylation in Case	2.91E-01 (Median)	Methylation in Control	2.11E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:1.16E-03; Z-score:1.00E+00
Methylation in Case	3.30E-01 (Median)	Methylation in Control	2.87E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	Body (cg18813959)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.08E-05; Z-score:-9.26E-01
Methylation in Case	8.00E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	Body (cg16005224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:6.54E-03; Z-score:4.99E-01
Methylation in Case	4.56E-01 (Median)	Methylation in Control	4.36E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A8 in breast cancer			[ 5 ]
Location	3'UTR (cg06162589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:3.54E-02; Z-score:-1.03E+00
Methylation in Case	5.35E-01 (Median)	Methylation in Control	6.01E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS1500 (cg18841298)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:4.38E-05; Z-score:1.33E+00
Methylation in Case	5.14E-01 (Median)	Methylation in Control	4.10E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS1500 (cg26622895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:4.42E-04; Z-score:-1.71E+00
Methylation in Case	8.89E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg12135976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.58E+00	Statistic Test	p-value:9.33E-04; Z-score:1.12E+00
Methylation in Case	1.52E-01 (Median)	Methylation in Control	9.65E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg13433302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.44E+00	Statistic Test	p-value:1.63E-03; Z-score:8.66E-01
Methylation in Case	8.20E-02 (Median)	Methylation in Control	5.70E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg26490054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:5.75E-03; Z-score:8.49E-01
Methylation in Case	4.04E-02 (Median)	Methylation in Control	3.33E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:5.07E-04; Z-score:9.86E-01
Methylation in Case	1.85E-01 (Median)	Methylation in Control	1.24E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg14730445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.97E+00	Statistic Test	p-value:5.90E-03; Z-score:6.66E-01
Methylation in Case	6.90E-02 (Median)	Methylation in Control	3.50E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:3.55E-02; Z-score:-1.15E+00
Methylation in Case	2.53E-01 (Median)	Methylation in Control	3.05E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A8 in clear cell renal cell carcinoma			[ 6 ]
Location	Body (cg16005224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:7.49E-03; Z-score:-2.26E+00
Methylation in Case	3.87E-01 (Median)	Methylation in Control	4.70E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in colon adenocarcinoma			[ 7 ]
Location	TSS1500 (cg24977541)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:1.98E-05; Z-score:-3.73E+00
Methylation in Case	6.21E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in colon adenocarcinoma			[ 7 ]
Location	TSS1500 (cg24314549)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:1.16E-04; Z-score:-9.85E-01
Methylation in Case	1.58E-01 (Median)	Methylation in Control	1.81E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in colon adenocarcinoma			[ 7 ]
Location	TSS1500 (cg10761097)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:1.14E-03; Z-score:-3.12E+00
Methylation in Case	7.72E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in colon adenocarcinoma			[ 7 ]
Location	Body (cg15053022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.03E-04; Z-score:1.78E+00
Methylation in Case	4.52E-01 (Median)	Methylation in Control	3.63E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in colon adenocarcinoma			[ 7 ]
Location	Body (cg22162312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:1.85E-04; Z-score:-2.66E+00
Methylation in Case	6.08E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in colon adenocarcinoma			[ 7 ]
Location	Body (cg14474561)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:2.90E-04; Z-score:-2.42E+00
Methylation in Case	3.38E-01 (Median)	Methylation in Control	4.37E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in colon adenocarcinoma			[ 7 ]
Location	Body (cg20954180)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:9.14E-04; Z-score:-2.28E+00
Methylation in Case	7.19E-01 (Median)	Methylation in Control	8.22E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A8 in colon adenocarcinoma			[ 7 ]
Location	Body (cg02034204)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:9.42E-04; Z-score:-1.22E+00
Methylation in Case	5.79E-01 (Median)	Methylation in Control	6.50E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	TSS1500 (cg27645544)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:5.77E-04; Z-score:-3.84E-01
Methylation in Case	7.44E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	TSS1500 (cg05193162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:8.51E-03; Z-score:-4.93E-01
Methylation in Case	6.24E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	TSS200 (cg13433302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:1.26E-06; Z-score:1.97E+00
Methylation in Case	2.78E-01 (Median)	Methylation in Control	2.14E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	TSS200 (cg26490054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:3.61E-05; Z-score:7.45E-01
Methylation in Case	8.43E-02 (Median)	Methylation in Control	7.11E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	TSS200 (cg12135976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:1.18E-04; Z-score:6.89E-01
Methylation in Case	3.25E-01 (Median)	Methylation in Control	2.83E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	1stExon (cg14730445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.59E+00	Statistic Test	p-value:1.65E-10; Z-score:2.97E+00
Methylation in Case	5.07E-01 (Median)	Methylation in Control	1.96E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:2.14E-06; Z-score:1.32E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	5.62E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:2.41E-05; Z-score:1.25E+00
Methylation in Case	6.52E-01 (Median)	Methylation in Control	5.53E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	Body (cg16287284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.51E-03; Z-score:-1.11E+00
Methylation in Case	7.41E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	Body (cg18813959)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:5.12E-03; Z-score:-9.17E-02
Methylation in Case	9.19E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A8 in colorectal cancer			[ 8 ]
Location	3'UTR (cg06162589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:8.01E-11; Z-score:-3.14E+00
Methylation in Case	5.91E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg13424870)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.30E+00	Statistic Test	p-value:2.28E-17; Z-score:2.82E+00
Methylation in Case	4.04E-01 (Median)	Methylation in Control	1.76E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg12135976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:1.34E-05; Z-score:-1.45E+00
Methylation in Case	1.51E-01 (Median)	Methylation in Control	2.11E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:5.09E-04; Z-score:-1.53E+00
Methylation in Case	2.09E-01 (Median)	Methylation in Control	2.65E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:4.04E-03; Z-score:1.18E+00
Methylation in Case	2.97E-01 (Median)	Methylation in Control	2.45E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg09455805)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.47E+00	Statistic Test	p-value:3.80E-20; Z-score:-2.13E+00
Methylation in Case	5.04E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg07878951)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:1.82E-14; Z-score:-6.91E+00
Methylation in Case	5.16E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg08362628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:6.64E-13; Z-score:-5.68E+00
Methylation in Case	6.12E-01 (Median)	Methylation in Control	7.92E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg17806661)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.52E+00	Statistic Test	p-value:1.49E-12; Z-score:-2.04E+00
Methylation in Case	2.73E-01 (Median)	Methylation in Control	4.15E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A8 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg16005224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:1.56E-04; Z-score:-2.16E+00
Methylation in Case	3.08E-01 (Median)	Methylation in Control	3.89E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	TSS1500 (cg05193162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.49E-04; Z-score:-8.42E-01
Methylation in Case	8.62E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	TSS1500 (cg27645544)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:4.60E-02; Z-score:-5.53E-01
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	TSS200 (cg26490054)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.54E+00	Statistic Test	p-value:4.60E-06; Z-score:1.32E+00
Methylation in Case	1.23E-01 (Median)	Methylation in Control	7.99E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	TSS200 (cg13433302)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:1.13E-04; Z-score:1.07E+00
Methylation in Case	2.05E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	TSS200 (cg12135976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:2.81E-04; Z-score:1.08E+00
Methylation in Case	3.47E-01 (Median)	Methylation in Control	2.75E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:5.14E-06; Z-score:1.88E+00
Methylation in Case	3.26E-01 (Median)	Methylation in Control	2.38E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	1stExon (cg14730445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.04E+00	Statistic Test	p-value:3.63E-05; Z-score:1.77E+00
Methylation in Case	1.82E-01 (Median)	Methylation in Control	8.91E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.65E-02; Z-score:3.43E-01
Methylation in Case	3.14E-01 (Median)	Methylation in Control	2.96E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	Body (cg16287284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:3.78E-02; Z-score:-5.99E-01
Methylation in Case	6.54E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	Body (cg16005224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.05E-02; Z-score:4.39E-01
Methylation in Case	4.98E-01 (Median)	Methylation in Control	4.67E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A8 in HIV infection			[ 10 ]
Location	3'UTR (cg06162589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.17E-04; Z-score:-2.12E+00
Methylation in Case	6.19E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg18143243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:4.56E+00	Statistic Test	p-value:1.77E-23; Z-score:4.53E+00
Methylation in Case	4.55E-01 (Median)	Methylation in Control	9.98E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg06794441)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:1.36E-05; Z-score:1.23E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg21861233)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.78E-05; Z-score:-3.92E-01
Methylation in Case	8.05E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg21507866)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.21E-03; Z-score:2.26E-01
Methylation in Case	1.02E-01 (Median)	Methylation in Control	9.62E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS200 (cg04191954)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:1.93E-08; Z-score:6.60E-01
Methylation in Case	1.42E-01 (Median)	Methylation in Control	1.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS200 (cg06748231)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:2.08E-04; Z-score:-6.38E-01
Methylation in Case	7.92E-02 (Median)	Methylation in Control	8.55E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS200 (cg23654327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:4.62E-03; Z-score:-7.89E-01
Methylation in Case	4.14E-02 (Median)	Methylation in Control	4.74E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg02190353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.54E+00	Statistic Test	p-value:1.02E-20; Z-score:-2.83E+00
Methylation in Case	3.50E-01 (Median)	Methylation in Control	5.38E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg14341131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.47E+00	Statistic Test	p-value:6.65E-10; Z-score:-2.06E+00
Methylation in Case	4.33E-01 (Median)	Methylation in Control	6.36E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg16548605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.51E-02; Z-score:5.73E-01
Methylation in Case	6.24E-01 (Median)	Methylation in Control	5.31E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A8 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg06556827)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:4.72E-02; Z-score:5.21E-01
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg27645544)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:8.47E-04; Z-score:-8.70E-01
Methylation in Case	7.80E-01 (Median)	Methylation in Control	8.22E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg26622895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.49E-03; Z-score:-9.28E-01
Methylation in Case	8.60E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg05193162)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.83E-03; Z-score:-7.90E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in papillary thyroid cancer			[ 12 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:3.02E-02; Z-score:4.82E-01
Methylation in Case	1.38E-01 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A8 in papillary thyroid cancer			[ 12 ]
Location	Body (cg16287284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:3.52E-02; Z-score:3.80E-01
Methylation in Case	5.56E-01 (Median)	Methylation in Control	5.29E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A8 in papillary thyroid cancer			[ 12 ]
Location	Body (cg16005224)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:3.76E-02; Z-score:1.00E+00
Methylation in Case	4.22E-01 (Median)	Methylation in Control	3.53E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A8 in papillary thyroid cancer			[ 12 ]
Location	3'UTR (cg06162589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.34E-06; Z-score:-1.13E+00
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Hypermethylation of SLC5A8 in papillary thyroid cancers			[ 18 ]
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Frequency	34 (40%) out of the 86 studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	The Hypermethylation status of SLC5A8 had been associated with advanced tumors, plurifocality, and extrathyroidal invasion.
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in prostate cancer			[ 13 ]
Location	TSS1500 (cg21090344)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.68E+00	Statistic Test	p-value:1.32E-04; Z-score:-5.49E+00
Methylation in Case	3.53E-01 (Median)	Methylation in Control	5.93E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in systemic lupus erythematosus			[ 14 ]
Location	TSS1500 (cg26622895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.12E-02; Z-score:-7.64E-02
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in systemic lupus erythematosus			[ 14 ]
Location	TSS1500 (cg27645544)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:4.04E-02; Z-score:-3.59E-02
Methylation in Case	7.28E-01 (Median)	Methylation in Control	7.31E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in systemic lupus erythematosus			[ 14 ]
Location	TSS200 (cg12135976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:3.62E-02; Z-score:3.46E-01
Methylation in Case	3.84E-01 (Median)	Methylation in Control	3.61E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in systemic lupus erythematosus			[ 14 ]
Location	3'UTR (cg06162589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.78E-02; Z-score:-1.50E-01
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.74E+00	Statistic Test	p-value:8.66E-24; Z-score:-3.78E+00
Methylation in Case	4.71E-01 (Median)	Methylation in Control	8.19E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A8 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	1stExon (cg10141715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:3.54E-20; Z-score:-4.62E+00
Methylation in Case	6.91E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A8 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	1stExon (cg14730445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:3.99E-19; Z-score:-3.42E+00
Methylation in Case	6.13E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A8 in atypical teratoid rhabdoid tumor			[ 16 ]
Location	3'UTR (cg06162589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.53E+00	Statistic Test	p-value:1.02E-13; Z-score:2.48E+00
Methylation in Case	6.02E-01 (Median)	Methylation in Control	2.38E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A8 in depression			[ 17 ]
Location	Body (cg16287284)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:3.26E-02; Z-score:-4.03E-01
Methylation in Case	5.43E-01 (Median)	Methylation in Control	5.72E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC5A8 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.07E-26; Fold-change:0.480638038; Z-score:2.818004899
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-200a directly targets SLC5A8			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-200a	miRNA Mature ID	miR-200a-5p
miRNA Sequence	CAUCUUACCGGACAGUGCUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-200b directly targets SLC5A8			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-200b	miRNA Mature ID	miR-200b-5p
miRNA Sequence	CAUCUUACUGGGCAGCAUUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-3151 directly targets SLC5A8			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3151	miRNA Mature ID	miR-3151-3p
miRNA Sequence	CCUGAUCCCACAGCCCACCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-3156 directly targets SLC5A8			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3156	miRNA Mature ID	miR-3156-5p
miRNA Sequence	AAAGAUCUGGAAGUGGGAGACA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon5	miR-4305 directly targets SLC5A8			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4305	miRNA Mature ID	miR-4305
miRNA Sequence	CCUAGACACCUCCAGUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon6	miR-4777 directly targets SLC5A8			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4777	miRNA Mature ID	miR-4777-3p
miRNA Sequence	AUACCUCAUCUAGAAUGCUGUA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon7	miR-570 directly targets SLC5A8			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-570	miRNA Mature ID	miR-570-3p
miRNA Sequence	CGAAAACAGCAAUUACCUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-640 directly targets SLC5A8			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-640	miRNA Mature ID	miR-640
miRNA Sequence	AUGAUCCAGGAACCUGCCUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-8485 directly targets SLC5A8			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8485	miRNA Mature ID	miR-8485
miRNA Sequence	CACACACACACACACACGUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	SLC5A8, a sodium transporter, is a tumor suppressor gene silenced by methylation in human colon aberrant crypt foci and cancers. Proc Natl Acad Sci U S A. 2003 Jul 8;100(14):8412-7.
2	Gene silencing of SLC5A8 identified by genome-wide methylation profiling in lung cancer. Lung Cancer. 2013 Mar;79(3):198-204.
3	Prognostic Significance of Aberrant Methylation of Solute Carrier Gene Family 5A8 in Lung Adenocarcinoma. Ann Thorac Surg. 2015 May;99(5):1755-9.
4	DNA Methylation Dynamics in Urological Tumors.
5	Genome-wide Scan for Methylation Profiles in Breast Cancer
6	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
16	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
17	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
18	Circulating cell-free DNA, SLC5A8 and SLC26A4 hypermethylation, BRAF(V600E): A non-invasive tool panel for early detection of thyroid cancer. Biomed Pharmacother. 2013 Oct;67(8):723-30.
19	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
20	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
21	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence