Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0426 Transporter Info
Gene Name SLC5A6
Transporter Name Sodium-dependent multivitamin transporter
Gene ID
8884
UniProt ID
Q9Y289
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

          43 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 let-7a directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7a miRNA Mature ID let-7a-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

 let-7b directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

 let-7c directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

 let-7d directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7d miRNA Mature ID let-7d-5p

miRNA Sequence

 AGAGGUAGUAGGUUGCAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

 let-7e directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

 UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

 let-7f directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7f miRNA Mature ID let-7f-5p

miRNA Sequence

 UGAGGUAGUAGAUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

 let-7g directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7g miRNA Mature ID let-7g-5p

miRNA Sequence

 UGAGGUAGUAGUUUGUACAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

 let-7i directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7i miRNA Mature ID let-7i-5p

miRNA Sequence

 UGAGGUAGUAGUUUGUGCUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

 miR-1252 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1252 miRNA Mature ID miR-1252-3p

miRNA Sequence

 CAAAUGAGCUUAAUUUCCUUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

 miR-1294 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1294 miRNA Mature ID miR-1294

miRNA Sequence

 UGUGAGGUUGGCAUUGUUGUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon11

 miR-139 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-139 miRNA Mature ID miR-139-3p

miRNA Sequence

 UGGAGACGCGGCCCUGUUGGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-24 directly targets SLC5A6 [ 3 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

 UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-27b directly targets SLC5A6 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-27b miRNA Mature ID miR-27b-3p

miRNA Sequence

 UUCACAGUGGCUAAGUUCUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

 miR-3138 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3138 miRNA Mature ID miR-3138

miRNA Sequence

 UGUGGACAGUGAGGUAGAGGGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon15

 miR-3148 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3148 miRNA Mature ID miR-3148

miRNA Sequence

 UGGAAAAAACUGGUGUGUGCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-3184 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3184 miRNA Mature ID miR-3184-5p

miRNA Sequence

 UGAGGGGCCUCAGACCGAGCUUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

 miR-3529 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3529 miRNA Mature ID miR-3529-5p

miRNA Sequence

 AGGUAGACUGGGAUUUGUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

 miR-3662 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3662 miRNA Mature ID miR-3662

miRNA Sequence

 GAAAAUGAUGAGUAGUGACUGAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon19

 miR-3689d directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

 GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

 miR-379 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-379 miRNA Mature ID miR-379-5p

miRNA Sequence

 UGGUAGACUAUGGAACGUAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon21

 miR-3927 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3927 miRNA Mature ID miR-3927-3p

miRNA Sequence

 CAGGUAGAUAUUUGAUAGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

 miR-423 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-423 miRNA Mature ID miR-423-5p

miRNA Sequence

 UGAGGGGCAGAGAGCGAGACUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon23

 miR-424 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-424 miRNA Mature ID miR-424-3p

miRNA Sequence

 CAAAACGUGAGGCGCUGCUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon24

 miR-4327 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4327 miRNA Mature ID miR-4327

miRNA Sequence

 GGCUUGCAUGGGGGACUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon25

 miR-4458 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4458 miRNA Mature ID miR-4458

miRNA Sequence

 AGAGGUAGGUGUGGAAGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

 miR-4500 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4500 miRNA Mature ID miR-4500

miRNA Sequence

 UGAGGUAGUAGUUUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

 miR-4524a directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4524a miRNA Mature ID miR-4524a-3p

miRNA Sequence

 UGAGACAGGCUUAUGCUGCUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon28

 miR-4524b directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4524b miRNA Mature ID miR-4524b-3p

miRNA Sequence

 GAGACAGGUUCAUGCUGCUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

 miR-4712 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4712 miRNA Mature ID miR-4712-3p

miRNA Sequence

 AAUGAGAGACCUGUACUGUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

 miR-4802 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4802 miRNA Mature ID miR-4802-5p

miRNA Sequence

 UAUGGAGGUUCUAGACCAUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon31

 miR-548c directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548c miRNA Mature ID miR-548c-3p

miRNA Sequence

 CAAAAAUCUCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

 miR-577 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-577 miRNA Mature ID miR-577

miRNA Sequence

 UAGAUAAAAUAUUGGUACCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon33

 miR-6085 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6085 miRNA Mature ID miR-6085

miRNA Sequence

 AAGGGGCUGGGGGAGCACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon34

 miR-6124 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6124 miRNA Mature ID miR-6124

miRNA Sequence

 GGGAAAAGGAAGGGGGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon35

 miR-6134 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

 UGAGGUGGUAGGAUGUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon36

 miR-636 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-636 miRNA Mature ID miR-636

miRNA Sequence

 UGUGCUUGCUCGUCCCGCCCGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon37

 miR-6515 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6515 miRNA Mature ID miR-6515-3p

miRNA Sequence

 UCUCUUCAUCUACCCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

 miR-6813 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6813 miRNA Mature ID miR-6813-5p

miRNA Sequence

 CAGGGGCUGGGGUUUCAGGUUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

 miR-6831 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6831 miRNA Mature ID miR-6831-5p

miRNA Sequence

 UAGGUAGAGUGUGAGGAGGAGGUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

 miR-6851 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

 AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

 miR-7854 directly targets SLC5A6 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7854 miRNA Mature ID miR-7854-3p

miRNA Sequence

 UGAGGUGACCGCAGAUGGGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon42

 miR-877 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-877 miRNA Mature ID miR-877-3p

miRNA Sequence

 UCCUCUUCUCCCUCCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

 miR-98 directly targets SLC5A6 [ 1 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

Methylation

  Meningioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Moderate hypomethylation of SLC5A6 in meningioma than that in healthy individual

Studied Phenotype

 Meningioma [ICD-11:2A01.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:1.15E-28; Fold-change:-0.221255029; Z-score:-4.46508184
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Brain neuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Significant hypomethylation of SLC5A6 in brain neuroblastoma than that in healthy individual

Studied Phenotype

 Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:1.17E-27; Fold-change:-0.459501451; Z-score:-10.39856543
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Melanoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Significant hypomethylation of SLC5A6 in melanoma than that in healthy individual

Studied Phenotype

 Melanoma [ICD-11:2C30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:9.95E-05; Fold-change:-0.344477761; Z-score:-5.493650728
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
References
1 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
2 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
3 miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25.
4 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.