Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0425 Transporter Info
Gene Name	SLC5A5
Transporter Name	Sodium/iodide cotransporter
Gene ID	6528
UniProt ID	Q92911

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg08140412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:1.10E-25; Z-score:-3.98E+00
Methylation in Case	3.11E-01 (Median)	Methylation in Control	4.24E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg09028651)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:2.05E-03; Z-score:7.31E-01
Methylation in Case	7.49E-01 (Median)	Methylation in Control	6.83E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:1.14E-06; Z-score:1.58E+00
Methylation in Case	7.41E-01 (Median)	Methylation in Control	4.97E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	1stExon (cg09597465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.69E-04; Z-score:-6.19E-01
Methylation in Case	9.68E-02 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg12178904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:2.84E-26; Z-score:-5.31E+00
Methylation in Case	6.08E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg02685680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:6.96E-08; Z-score:-1.73E+00
Methylation in Case	6.12E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg14014879)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:1.10E-07; Z-score:-1.67E+00
Methylation in Case	6.20E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg09725874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:5.66E-04; Z-score:-1.12E+00
Methylation in Case	3.15E-01 (Median)	Methylation in Control	3.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A5 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg21271026)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:1.41E-03; Z-score:9.13E-01
Methylation in Case	8.30E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	TSS1500 (cg10017118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:1.08E-06; Z-score:-1.04E+01
Methylation in Case	3.94E-01 (Median)	Methylation in Control	5.26E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	TSS1500 (cg17933226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:3.70E-03; Z-score:-6.05E+00
Methylation in Case	4.21E-01 (Median)	Methylation in Control	5.43E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	TSS200 (cg16701007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.55E+00	Statistic Test	p-value:5.23E-06; Z-score:-4.90E+00
Methylation in Case	2.09E-01 (Median)	Methylation in Control	3.22E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	TSS200 (cg21477717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:4.99E-03; Z-score:-3.04E+00
Methylation in Case	1.13E-01 (Median)	Methylation in Control	1.53E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	Body (cg22179256)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:1.84E-06; Z-score:-1.39E+01
Methylation in Case	6.26E-01 (Median)	Methylation in Control	8.09E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	Body (cg21522295)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:1.78E-04; Z-score:-5.03E+00
Methylation in Case	1.19E-01 (Median)	Methylation in Control	1.59E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	Body (cg15427234)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.28E+00	Statistic Test	p-value:3.64E-04; Z-score:6.13E+01
Methylation in Case	2.96E-01 (Median)	Methylation in Control	1.29E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	Body (cg10359333)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:5.37E-04; Z-score:-2.07E+01
Methylation in Case	8.90E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A5 in bladder cancer			[ 2 ]
Location	3'UTR (cg12562245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:5.61E-04; Z-score:-5.89E+00
Methylation in Case	6.33E-01 (Median)	Methylation in Control	7.42E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg17933226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:4.05E-05; Z-score:1.08E+00
Methylation in Case	5.31E-01 (Median)	Methylation in Control	4.40E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg10017118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.87E-03; Z-score:9.21E-01
Methylation in Case	5.22E-01 (Median)	Methylation in Control	4.87E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS200 (cg23222039)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.73E+00	Statistic Test	p-value:6.40E-13; Z-score:3.52E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	9.47E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS200 (cg21477717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.52E+00	Statistic Test	p-value:1.31E-10; Z-score:2.82E+00
Methylation in Case	1.96E-01 (Median)	Methylation in Control	1.29E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS200 (cg24065770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.94E+00	Statistic Test	p-value:2.49E-08; Z-score:1.66E+00
Methylation in Case	3.48E-02 (Median)	Methylation in Control	1.80E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS200 (cg16701007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:3.18E-08; Z-score:2.74E+00
Methylation in Case	4.05E-01 (Median)	Methylation in Control	3.13E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS200 (cg06697339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.51E+00	Statistic Test	p-value:1.20E-07; Z-score:3.12E+00
Methylation in Case	7.10E-02 (Median)	Methylation in Control	2.83E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS200 (cg01655355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:1.37E-04; Z-score:6.09E-01
Methylation in Case	5.45E-02 (Median)	Methylation in Control	4.49E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	TSS200 (cg02674588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:7.48E-03; Z-score:4.29E-01
Methylation in Case	8.08E-02 (Median)	Methylation in Control	7.21E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	1stExon (cg24881657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.99E+00	Statistic Test	p-value:8.43E-15; Z-score:4.54E+00
Methylation in Case	2.58E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	Body (cg21522295)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.43E+00	Statistic Test	p-value:3.55E-08; Z-score:2.36E+00
Methylation in Case	2.07E-01 (Median)	Methylation in Control	1.45E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	Body (cg15427234)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:1.11E-07; Z-score:1.41E+00
Methylation in Case	1.88E-01 (Median)	Methylation in Control	1.44E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	Body (cg10660916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:3.47E-05; Z-score:6.25E-01
Methylation in Case	2.81E-01 (Median)	Methylation in Control	2.37E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	Body (cg11340363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:3.61E-03; Z-score:7.66E-01
Methylation in Case	2.35E-02 (Median)	Methylation in Control	1.67E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC5A5 in breast cancer			[ 3 ]
Location	3'UTR (cg12562245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.00E-02; Z-score:-8.22E-01
Methylation in Case	6.76E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg17933226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:2.90E-05; Z-score:1.70E+00
Methylation in Case	6.65E-01 (Median)	Methylation in Control	5.34E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg06697339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.35E+00	Statistic Test	p-value:1.97E-05; Z-score:2.13E+00
Methylation in Case	3.06E-02 (Median)	Methylation in Control	2.27E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg01655355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:3.70E-05; Z-score:1.71E+00
Methylation in Case	1.90E-02 (Median)	Methylation in Control	1.31E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg23222039)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.46E+00	Statistic Test	p-value:9.94E-05; Z-score:1.65E+00
Methylation in Case	7.97E-02 (Median)	Methylation in Control	5.46E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg02674588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:1.68E-04; Z-score:1.21E+00
Methylation in Case	4.20E-02 (Median)	Methylation in Control	3.45E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg24065770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:2.72E-03; Z-score:9.75E-01
Methylation in Case	2.15E-02 (Median)	Methylation in Control	1.83E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg21477717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:6.24E-03; Z-score:5.70E-01
Methylation in Case	1.23E-01 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	1stExon (cg24881657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:2.79E-04; Z-score:7.85E-01
Methylation in Case	1.19E-01 (Median)	Methylation in Control	9.81E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg10660916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:2.24E-05; Z-score:2.20E+00
Methylation in Case	3.77E-01 (Median)	Methylation in Control	3.02E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg15427234)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.43E+00	Statistic Test	p-value:3.80E-05; Z-score:2.37E+00
Methylation in Case	1.80E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg11340363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.29E-02; Z-score:2.28E-01
Methylation in Case	3.72E-02 (Median)	Methylation in Control	3.61E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC5A5 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg12122403)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:1.38E-02; Z-score:7.32E-01
Methylation in Case	2.91E-02 (Median)	Methylation in Control	2.54E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg16678467)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:1.20E-05; Z-score:-3.53E+00
Methylation in Case	6.81E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg21861233)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:1.26E-05; Z-score:-2.72E+00
Methylation in Case	6.43E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg03273715)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:1.74E-05; Z-score:-3.52E+00
Methylation in Case	5.02E-01 (Median)	Methylation in Control	6.03E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	TSS200 (cg07769015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:4.77E-05; Z-score:-1.98E+00
Methylation in Case	3.69E-01 (Median)	Methylation in Control	4.88E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	TSS200 (cg07191594)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:7.19E-05; Z-score:1.70E+00
Methylation in Case	4.95E-01 (Median)	Methylation in Control	4.05E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	Body (cg27470827)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:1.45E-05; Z-score:-1.91E+00
Methylation in Case	4.58E-01 (Median)	Methylation in Control	5.83E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	Body (cg01420001)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:1.80E-05; Z-score:-3.22E+00
Methylation in Case	6.02E-01 (Median)	Methylation in Control	7.20E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	Body (cg15867963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:3.09E-05; Z-score:2.30E+00
Methylation in Case	5.89E-01 (Median)	Methylation in Control	4.21E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	Body (cg20662988)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.62E+00	Statistic Test	p-value:4.37E-04; Z-score:2.72E+00
Methylation in Case	3.52E-01 (Median)	Methylation in Control	2.17E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	Body (cg13805730)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:9.86E-04; Z-score:-1.80E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	Body (cg11112833)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.01E-03; Z-score:-1.11E+00
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC5A5 in colon adenocarcinoma			[ 5 ]
Location	Body (cg21181547)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:2.11E-03; Z-score:-2.60E+00
Methylation in Case	7.66E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg10017118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:6.23E-11; Z-score:-2.78E+00
Methylation in Case	6.83E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	TSS200 (cg23222039)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:1.73E-07; Z-score:1.75E+00
Methylation in Case	1.83E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	TSS200 (cg24065770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:3.17E-05; Z-score:8.46E-01
Methylation in Case	2.16E-02 (Median)	Methylation in Control	1.63E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	TSS200 (cg21477717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:8.72E-04; Z-score:7.23E-01
Methylation in Case	2.23E-01 (Median)	Methylation in Control	1.99E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	TSS200 (cg06697339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:1.13E-03; Z-score:6.64E-01
Methylation in Case	3.75E-02 (Median)	Methylation in Control	3.16E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	1stExon (cg24881657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:1.11E-07; Z-score:2.12E+00
Methylation in Case	1.94E-01 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	Body (cg22179256)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:8.33E-06; Z-score:-1.81E+00
Methylation in Case	8.77E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	Body (cg21522295)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:4.18E-04; Z-score:1.20E+00
Methylation in Case	2.39E-01 (Median)	Methylation in Control	1.78E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	Body (cg10660916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:5.10E-04; Z-score:7.05E-01
Methylation in Case	3.30E-01 (Median)	Methylation in Control	2.96E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	Body (cg15427234)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:5.45E-03; Z-score:-5.79E-01
Methylation in Case	1.57E-01 (Median)	Methylation in Control	1.78E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	Body (cg12122403)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:4.87E-02; Z-score:2.17E-01
Methylation in Case	1.10E-01 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC5A5 in colorectal cancer			[ 6 ]
Location	3'UTR (cg12562245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.32E-08; Z-score:-3.62E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg27645544)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.64E+00	Statistic Test	p-value:5.09E-18; Z-score:-3.45E+00
Methylation in Case	3.58E-01 (Median)	Methylation in Control	5.85E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg03640993)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:1.31E-10; Z-score:-3.41E+00
Methylation in Case	5.03E-01 (Median)	Methylation in Control	7.22E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg21396646)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:6.22E-10; Z-score:-3.60E+00
Methylation in Case	5.88E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg17933226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:6.50E-08; Z-score:-1.61E+00
Methylation in Case	5.14E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg16701007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:1.11E-07; Z-score:-2.28E+00
Methylation in Case	3.32E-01 (Median)	Methylation in Control	4.35E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg21477717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:3.78E-06; Z-score:-1.04E+00
Methylation in Case	1.53E-01 (Median)	Methylation in Control	1.90E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg01655355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:1.45E-04; Z-score:-5.55E-01
Methylation in Case	5.42E-02 (Median)	Methylation in Control	6.36E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg23222039)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:3.55E-04; Z-score:-9.23E-01
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.49E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg24065770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:5.61E-03; Z-score:-5.61E-01
Methylation in Case	3.08E-02 (Median)	Methylation in Control	4.31E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg02674588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.14E-02; Z-score:-3.67E-01
Methylation in Case	8.01E-02 (Median)	Methylation in Control	8.54E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	1stExon (cg24881657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.57E-03; Z-score:3.53E-01
Methylation in Case	1.88E-01 (Median)	Methylation in Control	1.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg25996290)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:1.79E-12; Z-score:-5.24E+00
Methylation in Case	5.73E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg25429150)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:1.12E-11; Z-score:-3.55E+00
Methylation in Case	5.59E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg06807030)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:1.62E-11; Z-score:-3.26E+00
Methylation in Case	6.18E-01 (Median)	Methylation in Control	7.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg10359333)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.69E-06; Z-score:-1.29E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC5A5 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg11340363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:5.45E-03; Z-score:1.59E-01
Methylation in Case	4.61E-02 (Median)	Methylation in Control	4.29E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in lung adenocarcinoma			[ 8 ]
Location	TSS1500 (cg17933226)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:4.51E-02; Z-score:1.02E+00
Methylation in Case	7.24E-01 (Median)	Methylation in Control	6.82E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg21477717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:2.33E-02; Z-score:2.56E+00
Methylation in Case	2.52E-01 (Median)	Methylation in Control	1.94E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg16701007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:2.87E-02; Z-score:1.37E+00
Methylation in Case	5.46E-01 (Median)	Methylation in Control	4.61E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg23222039)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:3.03E-02; Z-score:2.33E+00
Methylation in Case	2.12E-01 (Median)	Methylation in Control	1.46E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in lung adenocarcinoma			[ 8 ]
Location	1stExon (cg24881657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.86E+00	Statistic Test	p-value:4.35E-03; Z-score:5.05E+00
Methylation in Case	3.43E-01 (Median)	Methylation in Control	1.84E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in lung adenocarcinoma			[ 8 ]
Location	Body (cg21522295)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.52E+00	Statistic Test	p-value:3.80E-02; Z-score:3.23E+00
Methylation in Case	3.09E-01 (Median)	Methylation in Control	2.03E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Prostate cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in prostate cancer			[ 9 ]
Location	TSS1500 (cg11493924)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:4.45E-02; Z-score:-1.68E+00
Methylation in Case	6.77E-02 (Median)	Methylation in Control	8.47E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in prostate cancer			[ 9 ]
Location	TSS1500 (cg25507121)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.43E+00	Statistic Test	p-value:4.71E-02; Z-score:-3.13E+00
Methylation in Case	4.66E-01 (Median)	Methylation in Control	6.67E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in prostate cancer			[ 9 ]
Location	TSS200 (cg03045620)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:2.36E-02; Z-score:-4.34E+00
Methylation in Case	3.83E-01 (Median)	Methylation in Control	4.60E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in prostate cancer			[ 9 ]
Location	Body (cg01922613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:8.96E-03; Z-score:1.20E+01
Methylation in Case	7.17E-01 (Median)	Methylation in Control	5.07E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in prostate cancer			[ 9 ]
Location	Body (cg00232679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:1.32E-02; Z-score:2.72E+00
Methylation in Case	6.15E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in prostate cancer			[ 9 ]
Location	Body (cg23337754)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.58E+00	Statistic Test	p-value:4.76E-02; Z-score:-1.81E+00
Methylation in Case	6.94E-02 (Median)	Methylation in Control	1.79E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
HIV infection	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	TSS200 (cg21477717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:8.70E-07; Z-score:1.64E+00
Methylation in Case	2.29E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	TSS200 (cg24065770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.19E+00	Statistic Test	p-value:2.50E-06; Z-score:2.54E+00
Methylation in Case	7.46E-02 (Median)	Methylation in Control	3.40E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	TSS200 (cg23222039)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.56E+00	Statistic Test	p-value:1.20E-05; Z-score:2.27E+00
Methylation in Case	1.79E-01 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	TSS200 (cg06697339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.79E+00	Statistic Test	p-value:2.85E-05; Z-score:2.20E+00
Methylation in Case	6.86E-02 (Median)	Methylation in Control	3.84E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	TSS200 (cg01655355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.46E+00	Statistic Test	p-value:3.52E-04; Z-score:1.65E+00
Methylation in Case	7.71E-02 (Median)	Methylation in Control	5.28E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	TSS200 (cg02674588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:5.23E-03; Z-score:1.17E+00
Methylation in Case	9.53E-02 (Median)	Methylation in Control	7.79E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	1stExon (cg24881657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.72E+00	Statistic Test	p-value:2.14E-06; Z-score:2.70E+00
Methylation in Case	2.09E-01 (Median)	Methylation in Control	1.22E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	Body (cg10660916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:4.06E-08; Z-score:1.87E+00
Methylation in Case	3.39E-01 (Median)	Methylation in Control	2.63E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	Body (cg15427234)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:3.85E-04; Z-score:1.36E+00
Methylation in Case	1.27E-01 (Median)	Methylation in Control	1.01E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	Body (cg21522295)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:9.22E-03; Z-score:8.64E-01
Methylation in Case	1.09E-01 (Median)	Methylation in Control	9.54E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	Body (cg22179256)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.07E-02; Z-score:-4.68E-01
Methylation in Case	8.52E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC5A5 in HIV infection			[ 10 ]
Location	Body (cg11340363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:2.44E-02; Z-score:6.05E-01
Methylation in Case	4.02E-02 (Median)	Methylation in Control	2.84E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Panic disorder	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in panic disorder			[ 11 ]
Location	TSS200 (cg21477717)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.34E-01	Statistic Test	p-value:1.85E-04; Z-score:-4.98E-01
Methylation in Case	-3.07E+00 (Median)	Methylation in Control	-2.87E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in panic disorder			[ 11 ]
Location	TSS200 (cg24065770)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.64E-01	Statistic Test	p-value:4.45E-02; Z-score:-4.21E-01
Methylation in Case	-5.88E+00 (Median)	Methylation in Control	-5.67E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in panic disorder			[ 11 ]
Location	1stExon (cg24881657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.41E-01	Statistic Test	p-value:2.23E-02; Z-score:-4.40E-01
Methylation in Case	-3.64E+00 (Median)	Methylation in Control	-3.42E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in panic disorder			[ 11 ]
Location	Body (cg10660916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.12E-01	Statistic Test	p-value:1.10E-02; Z-score:-3.15E-01
Methylation in Case	-1.94E+00 (Median)	Methylation in Control	-1.77E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in papillary thyroid cancer			[ 12 ]
Location	TSS200 (cg23222039)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:5.23E-04; Z-score:-9.79E-01
Methylation in Case	1.02E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in papillary thyroid cancer			[ 12 ]
Location	Body (cg22179256)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.63E-03; Z-score:-5.41E-01
Methylation in Case	8.67E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in papillary thyroid cancer			[ 12 ]
Location	Body (cg21522295)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:4.21E-03; Z-score:-7.73E-01
Methylation in Case	1.34E-01 (Median)	Methylation in Control	1.65E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in systemic lupus erythematosus			[ 13 ]
Location	TSS200 (cg06697339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.28E-02; Z-score:8.76E-02
Methylation in Case	4.95E-02 (Median)	Methylation in Control	4.69E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg21522295)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.09E-02; Z-score:-2.56E-01
Methylation in Case	1.12E-01 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg10660916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.58E-02; Z-score:2.67E-01
Methylation in Case	3.01E-01 (Median)	Methylation in Control	2.87E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	1stExon (cg24881657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:2.03E-16; Z-score:-2.87E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A5 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	Body (cg10359333)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.44E-02; Z-score:-5.16E-01
Methylation in Case	8.28E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A5 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	Body (cg10660916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:1.70E-02; Z-score:9.07E-01
Methylation in Case	7.47E-01 (Median)	Methylation in Control	5.89E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A5 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	Body (cg11340363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.14E-02; Z-score:-2.41E-01
Methylation in Case	8.70E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC5A5 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	Body (cg12122403)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.43E+00	Statistic Test	p-value:2.67E-02; Z-score:-6.07E-01
Methylation in Case	1.12E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC5A5 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	3'UTR (cg12562245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:2.36E-11; Z-score:-2.21E+00
Methylation in Case	7.78E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A5 in depression			[ 15 ]
Location	Body (cg10660916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:4.77E-02; Z-score:5.86E-01
Methylation in Case	2.63E-01 (Median)	Methylation in Control	2.44E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC5A5 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.96E-08; Fold-change:0.365915694; Z-score:3.108466779
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC5A5 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:2.16E-09; Fold-change:0.310791842; Z-score:3.774794276
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Histone acetylation
Breast cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypoacetylation of SLC5A5 in breast cancer (compare with SAHA treatment counterpart cells)			[ 16 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC5A5	Experiment Method	Western Blot
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Multiple cell lines of human
Additional Notes	Levels of acetylated K9 and K14 were increased in high-responsive cells (MDA468) and reduced in low-responsive cells (MDA157). It is possible to hypothesize that decrease of H3 histone acetylation in low-responsive cells is not permissive for induction of high levels of NIS mRNA upon SAHA treatment.
Thyroid cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypoacetylation of SLC5A5 in thyroid cancer (compare with counterpart healthy thyroid cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC5A5	Experiment Method	Western Blot
Studied Phenotype	Thyroid cancer[ ICD-11:2D10]
Experimental Material	Multiple cell lines of human and rat
Additional Notes	Histone deacetylation occurred on all these lysine residues of histones at the SLC5A5 promoter upon the activation of MAPK by BRAF V600E.
Epigenetic Phenomenon2	Hypoacetylation of SLC5A5 in thyroid cancer (compare with counterpart healthy thyroid cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC5A5	Experiment Method	Western Blot
Studied Phenotype	Thyroid cancer[ ICD-11:2D10]
Experimental Material	Multiple cell lines of human and rat
Additional Notes	Histone deacetylation occurred on all these lysine residues of histones at the SLC5A5 promoter upon the activation of MAPK by BRAF V600E.
Epigenetic Phenomenon3	Hypoacetylation of SLC5A5 in thyroid cancer (compare with counterpart healthy thyroid cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC5A5	Experiment Method	Western Blot
Studied Phenotype	Thyroid cancer[ ICD-11:2D10]
Experimental Material	Multiple cell lines of human and rat
Additional Notes	Histone deacetylation occurred on all these lysine residues of histones at the SLC5A5 promoter upon the activation of MAPK by BRAF V600E.
Epigenetic Phenomenon4	Hypoacetylation of SLC5A5 in thyroid cancer (compare with counterpart healthy thyroid cells)			[ 17 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC5A5	Experiment Method	Western Blot
Studied Phenotype	Thyroid cancer[ ICD-11:2D10]
Experimental Material	Multiple cell lines of human and rat
Additional Notes	Histone deacetylation occurred on all these lysine residues of histones at the SLC5A5 promoter upon the activation of MAPK by BRAF V600E.
Epigenetic Phenomenon5	Hypoacetylation of SLC5A5 in thyroid cancer (compare with counterpart healthy thyroid cells)			[ 18 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC5A5	Experiment Method	Western Blot
Studied Phenotype	Thyroid cancer[ ICD-11:2D10]
Experimental Material	Multiple cell lines of human
Additional Notes	The underlying mechanism of HDACi-induced upregulation of SLC5A5 gene expression via improving the acetylation status of histone at the promoter was elucidated directly by ChIP assay
Epigenetic Phenomenon6	Hypoacetylation of SLC5A5 in thyroid cancer (compare with counterpart healthy thyroid cells)			[ 18 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC5A5	Experiment Method	Western Blot
Studied Phenotype	Thyroid cancer[ ICD-11:2D10]
Experimental Material	Multiple cell lines of human
Additional Notes	The underlying mechanism of HDACi-induced upregulation of SLC5A5 gene expression via improving the acetylation status of histone at the promoter was elucidated directly by ChIP assay
Epigenetic Phenomenon7	Hypoacetylation of SLC5A5 in thyroid cancer (compare with counterpart healthy thyroid cells)			[ 18 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Down regulation ofSLC5A5	Experiment Method	Western Blot
Studied Phenotype	Thyroid cancer[ ICD-11:2D10]
Experimental Material	Multiple cell lines of human
Additional Notes	The underlying mechanism of HDACi-induced upregulation of SLC5A5 gene expression via improving the acetylation status of histone at the promoter was elucidated directly by ChIP assay
microRNA
Unclear Phenotype	44 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-10a directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-10a	miRNA Mature ID	miR-10a-5p
miRNA Sequence	UACCCUGUAGAUCCGAAUUUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-10b directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-10b	miRNA Mature ID	miR-10b-5p
miRNA Sequence	UACCCUGUAGAACCGAAUUUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-1228 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1228	miRNA Mature ID	miR-1228-3p
miRNA Sequence	UCACACCUGCCUCGCCCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-149 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-149	miRNA Mature ID	miR-149-3p
miRNA Sequence	AGGGAGGGACGGGGGCUGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-1827 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1827	miRNA Mature ID	miR-1827
miRNA Sequence	UGAGGCAGUAGAUUGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-1910 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1910	miRNA Mature ID	miR-1910-3p
miRNA Sequence	GAGGCAGAAGCAGGAUGACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-2114 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-2114	miRNA Mature ID	miR-2114-3p
miRNA Sequence	CGAGCCUCAAGCAAGGGACUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-2467 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-2467	miRNA Mature ID	miR-2467-3p
miRNA Sequence	AGCAGAGGCAGAGAGGCUCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-30b directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-30b	miRNA Mature ID	miR-30b-3p
miRNA Sequence	CUGGGAGGUGGAUGUUUACUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-3192 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3192	miRNA Mature ID	miR-3192-5p
miRNA Sequence	UCUGGGAGGUUGUAGCAGUGGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-339 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-339	miRNA Mature ID	miR-339-5p
miRNA Sequence	UCCCUGUCCUCCAGGAGCUCACG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-34b directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-34b	miRNA Mature ID	miR-34b-3p
miRNA Sequence	CAAUCACUAACUCCACUGCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-3612 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3612	miRNA Mature ID	miR-3612
miRNA Sequence	AGGAGGCAUCUUGAGAAAUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-3614 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3614	miRNA Mature ID	miR-3614-5p
miRNA Sequence	CCACUUGGAUCUGAAGGCUGCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-3689c directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3689c	miRNA Mature ID	miR-3689c
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-377 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-377	miRNA Mature ID	miR-377-5p
miRNA Sequence	AGAGGUUGCCCUUGGUGAAUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-4257 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4257	miRNA Mature ID	miR-4257
miRNA Sequence	CCAGAGGUGGGGACUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-4421 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4421	miRNA Mature ID	miR-4421
miRNA Sequence	ACCUGUCUGUGGAAAGGAGCUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-4537 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4537	miRNA Mature ID	miR-4537
miRNA Sequence	UGAGCCGAGCUGAGCUUAGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-455 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-455	miRNA Mature ID	miR-455-3p
miRNA Sequence	GCAGUCCAUGGGCAUAUACAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-4684 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4684	miRNA Mature ID	miR-4684-5p
miRNA Sequence	CUCUCUACUGACUUGCAACAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-4715 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4715	miRNA Mature ID	miR-4715-5p
miRNA Sequence	AAGUUGGCUGCAGUUAAGGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-4728 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4728	miRNA Mature ID	miR-4728-5p
miRNA Sequence	UGGGAGGGGAGAGGCAGCAAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-548c directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548c	miRNA Mature ID	miR-548c-3p
miRNA Sequence	CAAAAAUCUCAAUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-5699 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5699	miRNA Mature ID	miR-5699-3p
miRNA Sequence	UCCUGUCUUUCCUUGUUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-593 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-593	miRNA Mature ID	miR-593-3p
miRNA Sequence	UGUCUCUGCUGGGGUUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-6086 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6086	miRNA Mature ID	miR-6086
miRNA Sequence	GGAGGUUGGGAAGGGCAGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-647 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-647	miRNA Mature ID	miR-647
miRNA Sequence	GUGGCUGCACUCACUUCCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-6499 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6499	miRNA Mature ID	miR-6499-3p
miRNA Sequence	AGCAGUGUUUGUUUUGCCCACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-650 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-650	miRNA Mature ID	miR-650
miRNA Sequence	AGGAGGCAGCGCUCUCAGGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-6500 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6500	miRNA Mature ID	miR-6500-3p
miRNA Sequence	ACACUUGUUGGGAUGACCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-6516 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6516	miRNA Mature ID	miR-6516-5p
miRNA Sequence	UUUGCAGUAACAGGUGUGAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-661 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-661	miRNA Mature ID	miR-661
miRNA Sequence	UGCCUGGGUCUCUGGCCUGCGCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-6732 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6732	miRNA Mature ID	miR-6732-3p
miRNA Sequence	UAACCCUGUCCUCUCCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-6779 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6779	miRNA Mature ID	miR-6779-5p
miRNA Sequence	CUGGGAGGGGCUGGGUUUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon36	miR-6785 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6785	miRNA Mature ID	miR-6785-5p
miRNA Sequence	UGGGAGGGCGUGGAUGAUGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-6799 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6799	miRNA Mature ID	miR-6799-5p
miRNA Sequence	GGGGAGGUGUGCAGGGCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon38	miR-6807 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6807	miRNA Mature ID	miR-6807-5p
miRNA Sequence	GUGAGCCAGUGGAAUGGAGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon39	miR-6818 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6818	miRNA Mature ID	miR-6818-3p
miRNA Sequence	UUGUCUCUUGUUCCUCACACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-6823 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6823	miRNA Mature ID	miR-6823-3p
miRNA Sequence	UGAGCCUCUCCUUCCCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon41	miR-6842 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6842	miRNA Mature ID	miR-6842-3p
miRNA Sequence	UUGGCUGGUCUCUGCUCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-6883 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6883	miRNA Mature ID	miR-6883-5p
miRNA Sequence	AGGGAGGGUGUGGUAUGGAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-6895 directly targets SLC5A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6895	miRNA Mature ID	miR-6895-3p
miRNA Sequence	UGUCUCUCGCCCUUGGCCUUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon44	miR-7106 directly targets SLC5A5			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7106	miRNA Mature ID	miR-7106-5p
miRNA Sequence	UGGGAGGAGGGGAUCUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
15	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
16	Histone post-translational modifications induced by histone deacetylase inhibition in transcriptional control units of NIS gene. Mol Biol Rep. 2014 Aug;41(8):5257-65.
17	Histone deacetylation of NIS promoter underlies BRAF V600E-promoted NIS silencing in thyroid cancer. Endocr Relat Cancer. 2014 Jan 30;21(2):161-73.
18	MAPK Inhibitors Enhance HDAC Inhibitor-Induced Redifferentiation in Papillary Thyroid Cancer Cells Harboring BRAF V600E: An In Vitro Study. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
19	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
20	TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence