Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0421 Transporter Info
Gene Name	SLC5A12
Transporter Name	Sodium-coupled monocarboxylate transporter 2
Gene ID	159963
UniProt ID	Q1EHB4

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in bladder cancer			[ 1 ]
Location	TSS1500 (cg17285335)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.69E+00	Statistic Test	p-value:2.71E-05; Z-score:-3.70E+00
Methylation in Case	3.75E-01 (Median)	Methylation in Control	6.32E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A12 in bladder cancer			[ 1 ]
Location	TSS1500 (cg20092728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:5.67E-05; Z-score:-1.35E+01
Methylation in Case	6.26E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A12 in bladder cancer			[ 1 ]
Location	TSS1500 (cg05862393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:8.93E-05; Z-score:-6.14E+00
Methylation in Case	6.86E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A12 in bladder cancer			[ 1 ]
Location	Body (cg13363904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.34E-02; Z-score:-1.25E+00
Methylation in Case	7.06E-01 (Median)	Methylation in Control	7.35E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in breast cancer			[ 2 ]
Location	TSS1500 (cg05862393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.38E-07; Z-score:-1.29E+00
Methylation in Case	6.75E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A12 in breast cancer			[ 2 ]
Location	TSS1500 (cg20092728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:3.18E-07; Z-score:-1.08E+00
Methylation in Case	6.33E-01 (Median)	Methylation in Control	6.92E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A12 in breast cancer			[ 2 ]
Location	TSS1500 (cg17285335)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.02E-02; Z-score:-9.05E-01
Methylation in Case	4.90E-01 (Median)	Methylation in Control	5.53E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A12 in breast cancer			[ 2 ]
Location	Body (cg13363904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.16E-03; Z-score:-5.75E-01
Methylation in Case	7.30E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg20092728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.54E-08; Z-score:-1.74E+00
Methylation in Case	8.31E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A12 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg05862393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:5.09E-05; Z-score:-1.05E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A12 in colorectal cancer			[ 3 ]
Location	Body (cg13363904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:5.77E-05; Z-score:-1.05E+00
Methylation in Case	7.22E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg20092728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:1.94E-09; Z-score:-1.37E+00
Methylation in Case	5.80E-01 (Median)	Methylation in Control	7.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A12 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg17285335)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:1.86E-03; Z-score:-9.13E-01
Methylation in Case	3.84E-01 (Median)	Methylation in Control	4.44E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in HIV infection			[ 5 ]
Location	TSS1500 (cg17285335)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:8.77E-05; Z-score:-1.79E+00
Methylation in Case	6.63E-01 (Median)	Methylation in Control	7.37E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A12 in HIV infection			[ 5 ]
Location	TSS1500 (cg20092728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.62E-02; Z-score:-6.80E-01
Methylation in Case	7.67E-01 (Median)	Methylation in Control	7.94E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in pancretic ductal adenocarcinoma			[ 6 ]
Location	TSS1500 (cg01717150)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.13E+00	Statistic Test	p-value:2.83E-23; Z-score:7.03E+00
Methylation in Case	1.68E-01 (Median)	Methylation in Control	7.89E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A12 in pancretic ductal adenocarcinoma			[ 6 ]
Location	TSS200 (cg04902729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.77E+00	Statistic Test	p-value:1.89E-17; Z-score:3.07E+00
Methylation in Case	4.70E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A12 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg03117487)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:7.74E-05; Z-score:-1.14E+00
Methylation in Case	7.64E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC5A12 in pancretic ductal adenocarcinoma			[ 6 ]
Location	Body (cg18954388)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:2.09E-03; Z-score:5.00E-01
Methylation in Case	2.83E-01 (Median)	Methylation in Control	2.67E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in panic disorder			[ 7 ]
Location	TSS1500 (cg20092728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:3.24E-02; Z-score:-5.83E-01
Methylation in Case	1.21E+00 (Median)	Methylation in Control	1.46E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in systemic lupus erythematosus			[ 8 ]
Location	TSS1500 (cg05862393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:6.31E-04; Z-score:-2.39E-01
Methylation in Case	8.47E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC5A12 in systemic lupus erythematosus			[ 8 ]
Location	TSS1500 (cg17285335)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:9.55E-03; Z-score:-1.38E-01
Methylation in Case	7.66E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC5A12 in systemic lupus erythematosus			[ 8 ]
Location	TSS1500 (cg20092728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.38E-02; Z-score:-2.47E-01
Methylation in Case	7.89E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in atypical teratoid rhabdoid tumor			[ 9 ]
Location	Body (cg13363904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.54E-02; Z-score:-3.96E-01
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC5A12 in papillary thyroid cancer			[ 10 ]
Location	Body (cg13363904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.24E-02; Z-score:-6.24E-02
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.70E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC5A12 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.01253393; Fold-change:0.209436962; Z-score:1.227128457
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Central neurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC5A12 in central neurocytoma than that in healthy individual
Studied Phenotype	Central neurocytoma [ICD-11:2A00.3]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000119506; Fold-change:-0.258210547; Z-score:-1.463769182
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Atypical teratoid rhabdoid tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in atypical teratoid rhabdoid tumour than that in healthy individual
Studied Phenotype	Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:6.19E-06; Fold-change:-0.382047702; Z-score:-1.341273506
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.019387019; Fold-change:-0.405847164; Z-score:-1.131701289
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000327767; Fold-change:-0.349166941; Z-score:-6.081573335
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.009250353; Fold-change:-0.307752446; Z-score:-1.214567145
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Esthesioneuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in esthesioneuroblastoma than that in healthy individual
Studied Phenotype	Esthesioneuroblastoma [ICD-11:2D50.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:2.16E-13; Fold-change:-0.526936734; Z-score:-3.030073113
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:9.55E-12; Fold-change:-0.428695517; Z-score:-1.986793405
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.008313845; Fold-change:-0.321909499; Z-score:-1.306302608
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Meningioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in meningioma than that in healthy individual
Studied Phenotype	Meningioma [ICD-11:2A01.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:4.06E-75; Fold-change:-0.541979682; Z-score:-3.256399877
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:3.79E-19; Fold-change:-0.695314519; Z-score:-3.502732817
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Obesity	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in obesity than that in healthy individual
Studied Phenotype	Obesity [ICD-11:5B81]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.06E-12; Fold-change:-0.424219606; Z-score:-3.527738705
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000595176; Fold-change:-0.384686586; Z-score:-1.294969551
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Pituitary adenoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC5A12 in pituitary adenoma than that in healthy individual
Studied Phenotype	Pituitary adenoma [ICD-11:2F37]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.69E-08; Fold-change:-0.367011051; Z-score:-5.534135025
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC5A12 in liver cancer than that in other disease section
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Other Disease Section	p-value:0.001832599; Fold-change:-0.210382134; Z-score:-0.921028035
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
microRNA
Unclear Phenotype	43 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1236 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1236	miRNA Mature ID	miR-1236-3p
miRNA Sequence	CCUCUUCCCCUUGUCUCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-130b directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-130b	miRNA Mature ID	miR-130b-5p
miRNA Sequence	ACUCUUUCCCUGUUGCACUAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-1470 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1470	miRNA Mature ID	miR-1470
miRNA Sequence	GCCCUCCGCCCGUGCACCCCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-181b directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-181b	miRNA Mature ID	miR-181b-3p
miRNA Sequence	CUCACUGAACAAUGAAUGCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-205 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-205	miRNA Mature ID	miR-205-5p
miRNA Sequence	UCCUUCAUUCCACCGGAGUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-2276 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2276	miRNA Mature ID	miR-2276-5p
miRNA Sequence	GCCCUCUGUCACCUUGCAGACG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-3124 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3124	miRNA Mature ID	miR-3124-3p
miRNA Sequence	ACUUUCCUCACUCCCGUGAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-4268 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4268	miRNA Mature ID	miR-4268
miRNA Sequence	GGCUCCUCCUCUCAGGAUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-4287 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4287	miRNA Mature ID	miR-4287
miRNA Sequence	UCUCCCUUGAGGGCACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-4420 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4420	miRNA Mature ID	miR-4420
miRNA Sequence	GUCACUGAUGUCUGUAGCUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-4446 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4446	miRNA Mature ID	miR-4446-5p
miRNA Sequence	AUUUCCCUGCCAUUCCCUUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-4448 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4448	miRNA Mature ID	miR-4448
miRNA Sequence	GGCUCCUUGGUCUAGGGGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-4469 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4469	miRNA Mature ID	miR-4469
miRNA Sequence	GCUCCCUCUAGGGUCGCUCGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-4659a directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4659a	miRNA Mature ID	miR-4659a-3p
miRNA Sequence	UUUCUUCUUAGACAUGGCAACG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-4659b directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4659b	miRNA Mature ID	miR-4659b-3p
miRNA Sequence	UUUCUUCUUAGACAUGGCAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-4667 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4667	miRNA Mature ID	miR-4667-3p
miRNA Sequence	UCCCUCCUUCUGUCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-4685 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4685	miRNA Mature ID	miR-4685-3p
miRNA Sequence	UCUCCCUUCCUGCCCUGGCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-4755 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4755	miRNA Mature ID	miR-4755-5p
miRNA Sequence	UUUCCCUUCAGAGCCUGGCUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-4768 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4768	miRNA Mature ID	miR-4768-5p
miRNA Sequence	AUUCUCUCUGGAUCCCAUGGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-4778 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4778	miRNA Mature ID	miR-4778-3p
miRNA Sequence	UCUUCUUCCUUUGCAGAGUUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-5006 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5006	miRNA Mature ID	miR-5006-3p
miRNA Sequence	UUUCCCUUUCCAUCCUGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-505 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-505	miRNA Mature ID	miR-505-3p
miRNA Sequence	CGUCAACACUUGCUGGUUUCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-5696 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5696	miRNA Mature ID	miR-5696
miRNA Sequence	CUCAUUUAAGUAGUCUGAUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-579 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-579	miRNA Mature ID	miR-579-3p
miRNA Sequence	UUCAUUUGGUAUAAACCGCGAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-627 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-627	miRNA Mature ID	miR-627-3p
miRNA Sequence	UCUUUUCUUUGAGACUCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-642a directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-642a	miRNA Mature ID	miR-642a-5p
miRNA Sequence	GUCCCUCUCCAAAUGUGUCUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-6515 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6515	miRNA Mature ID	miR-6515-3p
miRNA Sequence	UCUCUUCAUCUACCCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-653 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-653	miRNA Mature ID	miR-653-3p
miRNA Sequence	UUCACUGGAGUUUGUUUCAAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-664b directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-664b	miRNA Mature ID	miR-664b-3p
miRNA Sequence	UUCAUUUGCCUCCCAGCCUACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-6741 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6741	miRNA Mature ID	miR-6741-3p
miRNA Sequence	UCGGCUCUCUCCCUCACCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-6772 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6772	miRNA Mature ID	miR-6772-3p
miRNA Sequence	UUGCUCCUGACUCUGUGCCCACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-6809 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6809	miRNA Mature ID	miR-6809-3p
miRNA Sequence	CUUCUCUUCUCUCCUUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-6817 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6817	miRNA Mature ID	miR-6817-3p
miRNA Sequence	UCUCUCUGACUCCAUGGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-6833 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6833	miRNA Mature ID	miR-6833-3p
miRNA Sequence	UUUCUCUCUCCACUUCCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-6845 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6845	miRNA Mature ID	miR-6845-3p
miRNA Sequence	CCUCUCCUCCCUGUGCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon36	miR-6867 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6867	miRNA Mature ID	miR-6867-3p
miRNA Sequence	CUCUCCCUCUUUACCCACUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-6873 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6873	miRNA Mature ID	miR-6873-3p
miRNA Sequence	UUCUCUCUGUCUUUCUCUCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon38	miR-6875 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6875	miRNA Mature ID	miR-6875-3p
miRNA Sequence	AUUCUUCCUGCCCUGGCUCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon39	miR-6883 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6883	miRNA Mature ID	miR-6883-3p
miRNA Sequence	UUCCCUAUCUCACUCUCCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-6890 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6890	miRNA Mature ID	miR-6890-3p
miRNA Sequence	CCACUGCCUAUGCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon41	miR-6892 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6892	miRNA Mature ID	miR-6892-3p
miRNA Sequence	UCCCUCUCCCACCCCUUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-7110 directly targets SLC5A12			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7110	miRNA Mature ID	miR-7110-3p
miRNA Sequence	UCUCUCUCCCACUUCCCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-7113 directly targets SLC5A12			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7113	miRNA Mature ID	miR-7113-3p
miRNA Sequence	CCUCCCUGCCCGCCUCUCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
12	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence