General Information of Drug Transporter (DT)
DT ID DTD0394 Transporter Info
Gene Name SLC52A2
Transporter Name Riboflavin transporter 3
Gene ID
79581
UniProt ID
Q9HAB3
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-103a directly targets SLC52A2 [ 1 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-122 directly targets SLC52A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon3

miR-24 directly targets SLC52A2 [ 3 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-7 directly targets SLC52A2 [ 4 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-7 miRNA Mature ID miR-7-5p

miRNA Sequence

UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
2 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
3 miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25.
4 Regulation of epidermal growth factor receptor signaling in human cancer cells by microRNA-7. J Biol Chem. 2009 Feb 27;284(9):5731-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.