General Information of Drug Transporter (DT)
DT ID DTD0387 Transporter Info
Gene Name SLC4A7
Transporter Name Sodium bicarbonate cotransporter 3
Gene ID
9497
UniProt ID
Q9Y6M7
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in breast cancer [ 1 ]

Location

TSS1500 (cg18759850)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:3.45E-05; Z-score:1.48E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A7 in breast cancer [ 1 ]

Location

TSS1500 (cg06798189)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.50E-03; Z-score:-2.65E-01

Methylation in Case

8.69E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A7 in breast cancer [ 1 ]

Location

1stExon (cg00907274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:9.70E-13; Z-score:-3.17E+00

Methylation in Case

6.13E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A7 in breast cancer [ 1 ]

Location

Body (cg02344497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:6.60E-04; Z-score:1.08E+00

Methylation in Case

4.82E-01 (Median) Methylation in Control 4.07E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC4A7 in breast cancer [ 1 ]

Location

Body (cg21518279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.73E-02; Z-score:-3.40E-01

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

TSS1500 (cg18759850)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.38E-02; Z-score:-1.65E-01

Methylation in Case

6.80E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

1stExon (cg00907274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.37E-07; Z-score:-7.09E-01

Methylation in Case

7.06E-01 (Median) Methylation in Control 7.55E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

Body (cg03198012)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:1.46E-18; Z-score:-6.35E+00

Methylation in Case

4.62E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

Body (cg21518279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.53E-06; Z-score:-7.60E-01

Methylation in Case

8.56E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC4A7 in hepatocellular carcinoma [ 2 ]

Location

Body (cg02344497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:9.99E-05; Z-score:-1.13E+00

Methylation in Case

4.65E-01 (Median) Methylation in Control 5.47E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in HIV infection [ 3 ]

Location

TSS1500 (cg18759850)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.32E-04; Z-score:7.28E-01

Methylation in Case

9.30E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A7 in HIV infection [ 3 ]

Location

1stExon (cg00907274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:5.89E-03; Z-score:1.03E+00

Methylation in Case

9.03E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A7 in HIV infection [ 3 ]

Location

Body (cg21518279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:5.60E-04; Z-score:6.56E-01

Methylation in Case

9.37E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Panic disorder

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in panic disorder [ 4 ]

Location

TSS1500 (cg18759850)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-8.16E-01 Statistic Test p-value:1.95E-04; Z-score:-5.46E-01

Methylation in Case

-7.89E-01 (Median) Methylation in Control -6.43E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A7 in panic disorder [ 4 ]

Location

TSS1500 (cg06798189)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-8.47E-01 Statistic Test p-value:1.10E-03; Z-score:-4.23E-01

Methylation in Case

-7.89E-01 (Median) Methylation in Control -6.68E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A7 in panic disorder [ 4 ]

Location

1stExon (cg00907274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-7.23E-01 Statistic Test p-value:3.35E-04; Z-score:-6.01E-01

Methylation in Case

-7.26E-01 (Median) Methylation in Control -5.25E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A7 in panic disorder [ 4 ]

Location

Body (cg21518279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:3.87E-06; Z-score:-9.58E-01

Methylation in Case

1.24E+00 (Median) Methylation in Control 1.73E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC4A7 in panic disorder [ 4 ]

Location

Body (cg02344497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:5.12E-04; Z-score:-4.16E-01

Methylation in Case

1.08E+00 (Median) Methylation in Control 1.26E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in pancretic ductal adenocarcinoma [ 5 ]

Location

TSS200 (cg24499517)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.11E-04; Z-score:3.35E-01

Methylation in Case

3.91E-02 (Median) Methylation in Control 3.73E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A7 in pancretic ductal adenocarcinoma [ 5 ]

Location

Body (cg26637881)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:6.91E-08; Z-score:1.61E+00

Methylation in Case

8.26E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A7 in pancretic ductal adenocarcinoma [ 5 ]

Location

Body (cg14576436)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.93E-05; Z-score:-6.33E-01

Methylation in Case

6.33E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A7 in pancretic ductal adenocarcinoma [ 5 ]

Location

Body (cg05819249)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.07E-02; Z-score:-2.23E-01

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in atypical teratoid rhabdoid tumor [ 6 ]

Location

1stExon (cg00907274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.01E+00 Statistic Test p-value:4.91E-29; Z-score:4.05E+00

Methylation in Case

7.16E-01 (Median) Methylation in Control 3.57E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A7 in atypical teratoid rhabdoid tumor [ 6 ]

Location

Body (cg02344497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:1.49E-04; Z-score:-8.50E-01

Methylation in Case

3.00E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in bladder cancer [ 7 ]

Location

1stExon (cg00907274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:1.31E-07; Z-score:-1.50E+01

Methylation in Case

5.98E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A7 in bladder cancer [ 7 ]

Location

Body (cg21518279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.89E-02; Z-score:-1.11E+00

Methylation in Case

8.36E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in lung adenocarcinoma [ 8 ]

Location

1stExon (cg00907274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.51E-03; Z-score:-2.67E+00

Methylation in Case

7.99E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in colorectal cancer [ 9 ]

Location

Body (cg21518279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.45E-04; Z-score:-1.37E+00

Methylation in Case

9.29E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A7 in colorectal cancer [ 9 ]

Location

Body (cg02344497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:9.86E-03; Z-score:7.47E-01

Methylation in Case

7.02E-01 (Median) Methylation in Control 6.12E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in depression [ 10 ]

Location

Body (cg21518279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:3.30E-02; Z-score:4.33E-01

Methylation in Case

8.47E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A7 in prostate cancer [ 11 ]

Location

Body (cg10206931)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:1.37E-02; Z-score:1.98E+00

Methylation in Case

8.77E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-106b directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-17 directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-19b directly targets SLC4A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-20a directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-20b directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-25 directly targets SLC4A7 [ 14 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-25 miRNA Mature ID miR-25-3p

miRNA Sequence

CAUUGCACUUGUCUCGGUCUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-30a directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-30b directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30b miRNA Mature ID miR-30b-5p

miRNA Sequence

UGUAAACAUCCUACACUCAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-30c directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30c miRNA Mature ID miR-30c-5p

miRNA Sequence

UGUAAACAUCCUACACUCUCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-30d directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30d miRNA Mature ID miR-30d-5p

miRNA Sequence

UGUAAACAUCCCCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-30e directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30e miRNA Mature ID miR-30e-5p

miRNA Sequence

UGUAAACAUCCUUGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-34a directly targets SLC4A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-34a miRNA Mature ID miR-34a-5p

miRNA Sequence

UGGCAGUGUCUUAGCUGGUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-519d directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-93 directly targets SLC4A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
4 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
7 DNA Methylation Dynamics in Urological Tumors.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
10 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
13 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
14 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.