General Information of Drug Transporter (DT)
DT ID DTD0381 Transporter Info
Gene Name SLC4A10
Transporter Name Sodium-driven chloride bicarbonate exchanger
Gene ID
57282
UniProt ID
Q6U841
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in pancretic ductal adenocarcinoma [ 1 ]

Location

5'UTR (cg05937737)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.85E+00 Statistic Test p-value:3.14E-13; Z-score:2.39E+00

Methylation in Case

5.34E-01 (Median) Methylation in Control 2.88E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in pancretic ductal adenocarcinoma [ 1 ]

Location

5'UTR (cg04177287)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:5.78E-03; Z-score:-6.47E-01

Methylation in Case

4.99E-01 (Median) Methylation in Control 5.45E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A10 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg24163360)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.22E-03; Z-score:-8.04E-01

Methylation in Case

7.54E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A10 in pancretic ductal adenocarcinoma [ 1 ]

Location

3'UTR (cg17652998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.47E-02; Z-score:-8.12E-01

Methylation in Case

8.69E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in bladder cancer [ 2 ]

Location

TSS1500 (cg09715906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:3.15E-06; Z-score:-6.39E+00

Methylation in Case

5.86E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in bladder cancer [ 2 ]

Location

TSS1500 (cg20361238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.08E-02; Z-score:-1.36E-01

Methylation in Case

7.99E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A10 in bladder cancer [ 2 ]

Location

Body (cg07262519)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.83E+00 Statistic Test p-value:9.58E-11; Z-score:-2.35E+01

Methylation in Case

4.63E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A10 in bladder cancer [ 2 ]

Location

3'UTR (cg06581825)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.93E+00 Statistic Test p-value:2.66E-08; Z-score:-9.34E+00

Methylation in Case

4.61E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in breast cancer [ 3 ]

Location

TSS1500 (cg20361238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.51E-02; Z-score:-4.11E-01

Methylation in Case

8.40E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in breast cancer [ 3 ]

Location

TSS1500 (cg09715906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:3.44E-02; Z-score:1.98E-02

Methylation in Case

7.62E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A10 in breast cancer [ 3 ]

Location

TSS200 (cg15240455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:1.89E-02; Z-score:6.60E-01

Methylation in Case

1.01E-01 (Median) Methylation in Control 8.42E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A10 in breast cancer [ 3 ]

Location

Body (cg07262519)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:9.94E-10; Z-score:-2.71E+00

Methylation in Case

7.61E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC4A10 in breast cancer [ 3 ]

Location

3'UTR (cg06581825)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.41E-06; Z-score:-8.50E-01

Methylation in Case

8.59E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in lung adenocarcinoma [ 4 ]

Location

TSS1500 (cg09715906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:9.19E-03; Z-score:-1.72E+00

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in lung adenocarcinoma [ 4 ]

Location

3'UTR (cg06581825)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.22E-02; Z-score:-2.85E+00

Methylation in Case

8.52E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in panic disorder [ 5 ]

Location

TSS1500 (cg09715906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.47E-02; Z-score:-2.64E-01

Methylation in Case

2.12E+00 (Median) Methylation in Control 2.22E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in panic disorder [ 5 ]

Location

TSS200 (cg15240455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.10E-01 Statistic Test p-value:4.86E-02; Z-score:5.04E-01

Methylation in Case

-3.25E+00 (Median) Methylation in Control -3.57E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg20361238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:2.06E-02; Z-score:-8.77E-02

Methylation in Case

8.92E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in papillary thyroid cancer [ 6 ]

Location

Body (cg07262519)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.94E-04; Z-score:-5.79E-01

Methylation in Case

9.09E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A10 in papillary thyroid cancer [ 6 ]

Location

3'UTR (cg06581825)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.69E-02; Z-score:7.84E-01

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in systemic lupus erythematosus [ 7 ]

Location

TSS1500 (cg20361238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.96E-02; Z-score:-9.80E-02

Methylation in Case

8.90E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in systemic lupus erythematosus [ 7 ]

Location

Body (cg07262519)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.12E-02; Z-score:-4.93E-02

Methylation in Case

8.50E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Colorectal cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in colorectal cancer [ 8 ]

Location

TSS200 (cg15240455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.75E-02; Z-score:3.52E-01

Methylation in Case

1.63E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in colorectal cancer [ 8 ]

Location

Body (cg07262519)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.28E-08; Z-score:-1.91E+00

Methylation in Case

8.55E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in hepatocellular carcinoma [ 9 ]

Location

TSS200 (cg15240455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:3.42E-02; Z-score:-1.03E+00

Methylation in Case

9.62E-02 (Median) Methylation in Control 1.20E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in hepatocellular carcinoma [ 9 ]

Location

Body (cg15573830)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:1.77E-15; Z-score:-3.34E+00

Methylation in Case

3.28E-01 (Median) Methylation in Control 5.00E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A10 in hepatocellular carcinoma [ 9 ]

Location

Body (cg15989525)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:1.43E-12; Z-score:-4.14E+00

Methylation in Case

6.51E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A10 in hepatocellular carcinoma [ 9 ]

Location

3'UTR (cg06581825)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.62E-07; Z-score:-1.95E+00

Methylation in Case

8.73E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in HIV infection [ 10 ]

Location

TSS200 (cg15240455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:4.38E-02; Z-score:3.62E-01

Methylation in Case

1.63E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in HIV infection [ 10 ]

Location

Body (cg07262519)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.15E-03; Z-score:-1.25E+00

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg02713266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.23E-04; Z-score:-5.92E-01

Methylation in Case

8.55E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A10 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg07262519)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.71E-03; Z-score:-3.40E-01

Methylation in Case

7.48E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A10 in atypical teratoid rhabdoid tumor [ 11 ]

Location

3'UTR (cg06581825)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.44E-13; Z-score:-2.20E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A10 in prostate cancer [ 12 ]

Location

3'UTR (cg20536841)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.96E-02; Z-score:1.78E+00

Methylation in Case

9.37E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Arterial aneurysm

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC4A10 in arterial aneurysm than that in healthy individual

Studied Phenotype

Arterial aneurysm [ICD-11:BD51]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.00514222; Fold-change:0.22774346; Z-score:8.052608743
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Atypical teratoid rhabdoid tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC4A10 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.64E-08; Fold-change:0.287142135; Z-score:1.269651465
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Melanocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC4A10 in melanocytoma than that in healthy individual

Studied Phenotype

Melanocytoma [ICD-11:2F36.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.44E-07; Fold-change:0.206614904; Z-score:6.348297337
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC4A10 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.96E-19; Fold-change:0.548319184; Z-score:2.968912487
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Melanoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC4A10 in melanoma than that in healthy individual

Studied Phenotype

Melanoma [ICD-11:2C30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.90E-06; Fold-change:0.561849083; Z-score:2.841654786
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-30a directly targets SLC4A10 [ 13 ]

Epigenetic Type

microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.