General Information of Drug Transporter (DT)
DT ID DTD0380 Transporter Info
Gene Name SLC4A1
Transporter Name Anion exchange protein 1
Gene ID
6521
UniProt ID
P02730
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in breast cancer [ 1 ]

Location

5'UTR (cg02998129)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:9.72E-03; Z-score:4.35E-01

Methylation in Case

7.96E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A1 in breast cancer [ 1 ]

Location

TSS1500 (cg04433322)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:1.97E-23; Z-score:-4.18E+00

Methylation in Case

4.50E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A1 in breast cancer [ 1 ]

Location

TSS1500 (cg16464328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:3.28E-11; Z-score:-1.65E+00

Methylation in Case

7.17E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A1 in breast cancer [ 1 ]

Location

TSS200 (cg24607642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.37E+00 Statistic Test p-value:4.91E-15; Z-score:-3.06E+00

Methylation in Case

5.10E-01 (Median) Methylation in Control 7.00E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC4A1 in breast cancer [ 1 ]

Location

TSS200 (cg23728471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:3.13E-07; Z-score:-1.51E+00

Methylation in Case

6.99E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC4A1 in breast cancer [ 1 ]

Location

Body (cg14381448)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:3.12E-13; Z-score:-2.06E+00

Methylation in Case

5.41E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in lung adenocarcinoma [ 2 ]

Location

5'UTR (cg02998129)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:7.59E-06; Z-score:4.21E+00

Methylation in Case

8.43E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A1 in lung adenocarcinoma [ 2 ]

Location

TSS1500 (cg04433322)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:3.06E-02; Z-score:-1.58E+00

Methylation in Case

5.97E-01 (Median) Methylation in Control 6.94E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

5'UTR (cg21252914)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.70E+00 Statistic Test p-value:1.76E-17; Z-score:2.51E+00

Methylation in Case

1.50E-01 (Median) Methylation in Control 8.83E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg14453449)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.99E-03; Z-score:1.06E+00

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg03612649)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.57E-02; Z-score:-5.79E-01

Methylation in Case

8.92E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in papillary thyroid cancer [ 4 ]

Location

5'UTR (cg02998129)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.47E-10; Z-score:1.71E+00

Methylation in Case

8.42E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A1 in papillary thyroid cancer [ 4 ]

Location

TSS1500 (cg04433322)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.51E-03; Z-score:-5.06E-01

Methylation in Case

7.38E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A1 in papillary thyroid cancer [ 4 ]

Location

TSS200 (cg23728471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.62E-03; Z-score:-7.30E-01

Methylation in Case

8.49E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A1 in papillary thyroid cancer [ 4 ]

Location

TSS200 (cg24607642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.00E-03; Z-score:-1.70E-01

Methylation in Case

7.89E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Bladder cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in bladder cancer [ 5 ]

Location

TSS1500 (cg04433322)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.49E+00 Statistic Test p-value:1.53E-13; Z-score:-1.87E+01

Methylation in Case

2.10E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A1 in bladder cancer [ 5 ]

Location

TSS1500 (cg16464328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.65E+00 Statistic Test p-value:3.13E-10; Z-score:-1.23E+01

Methylation in Case

4.10E-01 (Median) Methylation in Control 6.78E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A1 in bladder cancer [ 5 ]

Location

TSS200 (cg23728471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.67E+00 Statistic Test p-value:1.08E-07; Z-score:-8.65E+00

Methylation in Case

3.73E-01 (Median) Methylation in Control 6.23E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A1 in bladder cancer [ 5 ]

Location

TSS200 (cg24607642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.05E+00 Statistic Test p-value:3.20E-06; Z-score:-5.37E+00

Methylation in Case

2.00E-01 (Median) Methylation in Control 4.11E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC4A1 in bladder cancer [ 5 ]

Location

Body (cg14381448)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.52E+00 Statistic Test p-value:7.77E-06; Z-score:-6.94E+00

Methylation in Case

3.85E-01 (Median) Methylation in Control 5.85E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC4A1 in bladder cancer [ 5 ]

Location

3'UTR (cg02892423)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:2.98E-05; Z-score:-7.15E+00

Methylation in Case

6.59E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Colorectal cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in colorectal cancer [ 6 ]

Location

TSS1500 (cg16464328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.49E-02; Z-score:-5.35E-01

Methylation in Case

6.83E-01 (Median) Methylation in Control 7.30E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A1 in colorectal cancer [ 6 ]

Location

TSS1500 (cg04433322)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:3.37E-02; Z-score:-5.24E-01

Methylation in Case

5.18E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A1 in colorectal cancer [ 6 ]

Location

TSS200 (cg24607642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:6.68E-07; Z-score:-1.96E+00

Methylation in Case

5.44E-01 (Median) Methylation in Control 6.57E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A1 in colorectal cancer [ 6 ]

Location

TSS200 (cg23728471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.36E-05; Z-score:-1.20E+00

Methylation in Case

8.44E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC4A1 in colorectal cancer [ 6 ]

Location

Body (cg14381448)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:1.33E-13; Z-score:-3.37E+00

Methylation in Case

4.17E-01 (Median) Methylation in Control 6.68E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC4A1 in colorectal cancer [ 6 ]

Location

3'UTR (cg02892423)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.02E-04; Z-score:-1.05E+00

Methylation in Case

8.98E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg05862393)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:1.89E-11; Z-score:-1.92E+00

Methylation in Case

6.28E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A1 in hepatocellular carcinoma [ 7 ]

Location

TSS200 (cg23728471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.56E-07; Z-score:-2.11E+00

Methylation in Case

7.53E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A1 in hepatocellular carcinoma [ 7 ]

Location

TSS200 (cg24607642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:7.00E-03; Z-score:-5.01E-01

Methylation in Case

6.63E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A1 in hepatocellular carcinoma [ 7 ]

Location

Body (cg14381448)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.04E-09; Z-score:-2.13E+00

Methylation in Case

5.55E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC4A1 in hepatocellular carcinoma [ 7 ]

Location

3'UTR (cg02892423)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:9.26E-05; Z-score:-7.89E-01

Methylation in Case

7.16E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Prostate cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in prostate cancer [ 8 ]

Location

TSS200 (cg00868652)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:2.71E-03; Z-score:3.79E+00

Methylation in Case

8.24E-01 (Median) Methylation in Control 6.25E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC4A1 in prostate cancer [ 8 ]

Location

Body (cg08351607)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:8.78E-03; Z-score:2.80E+00

Methylation in Case

8.97E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC4A1 in prostate cancer [ 8 ]

Location

Body (cg27576259)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:1.24E-02; Z-score:-2.86E+00

Methylation in Case

4.11E-01 (Median) Methylation in Control 5.35E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC4A1 in prostate cancer [ 8 ]

Location

Body (cg22566355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:2.02E-02; Z-score:1.59E+00

Methylation in Case

7.17E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A1 in panic disorder [ 9 ]

Location

Body (cg14381448)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-9.22E-01 Statistic Test p-value:3.59E-02; Z-score:-3.26E-01

Methylation in Case

-2.27E+00 (Median) Methylation in Control -2.09E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC4A1 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.60E-07; Fold-change:-0.281820038; Z-score:-2.114948546
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Multilayered rosettes embryonal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC4A1 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:6.74E-23; Fold-change:-0.627280216; Z-score:-5.745036708
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lung cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC4A1 in lung cancer than that in other disease section

Studied Phenotype

Lung cancer [ICD-11:2C25]

The Methylation Level of Disease Section Compare with the Other Disease Section

p-value:.; Fold-change:.; Z-score:.
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients

microRNA

  Unclear Phenotype

         59 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-105 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-105 miRNA Mature ID miR-105-5p

miRNA Sequence

UCAAAUGCUCAGACUCCUGUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1182 directly targets SLC4A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1182 miRNA Mature ID miR-1182

miRNA Sequence

GAGGGUCUUGGGAGGGAUGUGAC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon3

miR-122 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-1224 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-1244 directly targets SLC4A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1244 miRNA Mature ID miR-1244

miRNA Sequence

AAGUAGUUGGUUUGUAUGAGAUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-1267 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1267 miRNA Mature ID miR-1267

miRNA Sequence

CCUGUUGAAGUGUAAUCCCCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-129 directly targets SLC4A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon8

miR-1306 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1306 miRNA Mature ID miR-1306-5p

miRNA Sequence

CCACCUCCCCUGCAAACGUCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-130b directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-130b miRNA Mature ID miR-130b-5p

miRNA Sequence

ACUCUUUCCCUGUUGCACUAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-143 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-143 miRNA Mature ID miR-143-5p

miRNA Sequence

GGUGCAGUGCUGCAUCUCUGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-193b directly targets SLC4A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-193b miRNA Mature ID miR-193b-5p

miRNA Sequence

CGGGGUUUUGAGGGCGAGAUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-197 directly targets SLC4A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-197 miRNA Mature ID miR-197-3p

miRNA Sequence

UUCACCACCUUCUCCACCCAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-3135b directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

miR-3183 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3183 miRNA Mature ID miR-3183

miRNA Sequence

GCCUCUCUCGGAGUCGCUCGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-3187 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3187 miRNA Mature ID miR-3187-3p

miRNA Sequence

UUGGCCAUGGGGCUGCGCGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-3652 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

CGGCUGGAGGUGUGAGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-3663 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3663 miRNA Mature ID miR-3663-5p

miRNA Sequence

GCUGGUCUGCGUGGUGCUCGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-367 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-367 miRNA Mature ID miR-367-5p

miRNA Sequence

ACUGUUGCUAAUAUGCAACUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon19

miR-3672 directly targets SLC4A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3672 miRNA Mature ID miR-3672

miRNA Sequence

AUGAGACUCAUGUAAAACAUCUU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon20

miR-371a directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-371a miRNA Mature ID miR-371a-5p

miRNA Sequence

ACUCAAACUGUGGGGGCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-371b directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-372 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-372 miRNA Mature ID miR-372-5p

miRNA Sequence

CCUCAAAUGUGGAGCACUAUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-373 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-378a directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-378a miRNA Mature ID miR-378a-5p

miRNA Sequence

CUCCUGACUCCAGGUCCUGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-4423 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4423 miRNA Mature ID miR-4423-5p

miRNA Sequence

AGUUGCCUUUUUGUUCCCAUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

miR-4430 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

AGGCUGGAGUGAGCGGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-4435 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4435 miRNA Mature ID miR-4435

miRNA Sequence

AUGGCCAGAGCUCACACAGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-4454 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4454 miRNA Mature ID miR-4454

miRNA Sequence

GGAUCCGAGUCACGGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-4524a directly targets SLC4A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4524a miRNA Mature ID miR-4524a-3p

miRNA Sequence

UGAGACAGGCUUAUGCUGCUAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon30

miR-4524b directly targets SLC4A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4524b miRNA Mature ID miR-4524b-3p

miRNA Sequence

GAGACAGGUUCAUGCUGCUA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon31

miR-4691 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4691 miRNA Mature ID miR-4691-3p

miRNA Sequence

CCAGCCACGGACUGAGAGUGCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-4701 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4701 miRNA Mature ID miR-4701-5p

miRNA Sequence

UUGGCCACCACACCUACCCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-4716 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4716 miRNA Mature ID miR-4716-5p

miRNA Sequence

UCCAUGUUUCCUUCCCCCUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-4723 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4723 miRNA Mature ID miR-4723-3p

miRNA Sequence

CCCUCUCUGGCUCCUCCCCAAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-4753 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4753 miRNA Mature ID miR-4753-3p

miRNA Sequence

UUCUCUUUCUUUAGCCUUGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-4755 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4755 miRNA Mature ID miR-4755-3p

miRNA Sequence

AGCCAGGCUCUGAAGGGAAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-4781 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4781 miRNA Mature ID miR-4781-3p

miRNA Sequence

AAUGUUGGAAUCCUCGCUAGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-504 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-504 miRNA Mature ID miR-504-3p

miRNA Sequence

GGGAGUGCAGGGCAGGGUUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

miR-5193 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5193 miRNA Mature ID miR-5193

miRNA Sequence

UCCUCCUCUACCUCAUCCCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-548s directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548s miRNA Mature ID miR-548s

miRNA Sequence

AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-5698 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

miR-588 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-588 miRNA Mature ID miR-588

miRNA Sequence

UUGGCCACAAUGGGUUAGAAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-6131 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6131 miRNA Mature ID miR-6131

miRNA Sequence

GGCUGGUCAGAUGGGAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-616 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-6499 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

miR-6501 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6501 miRNA Mature ID miR-6501-5p

miRNA Sequence

AGUUGCCAGGGCUGCCUUUGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-6727 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

UCCUGCCACCUCCUCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-6769b directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6769b miRNA Mature ID miR-6769b-3p

miRNA Sequence

CCCUCUCUGUCCCACCCAUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon49

miR-6790 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6790 miRNA Mature ID miR-6790-3p

miRNA Sequence

CGACCUCGGCGACCCCUCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-6812 directly targets SLC4A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6812 miRNA Mature ID miR-6812-3p

miRNA Sequence

CCGCUCUUCCCCUGACCCCAG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon51

miR-6821 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6821 miRNA Mature ID miR-6821-3p

miRNA Sequence

UGACCUCUCCGCUCCGCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-6843 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6843 miRNA Mature ID miR-6843-3p

miRNA Sequence

AUGGUCUCCUGUUCUCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon53

miR-6848 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6848 miRNA Mature ID miR-6848-3p

miRNA Sequence

GUGGUCUCUUGGCCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon54

miR-6864 directly targets SLC4A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6864 miRNA Mature ID miR-6864-3p

miRNA Sequence

GUGAGACUUCUCUCCCUUCAG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon55

miR-7111 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7111 miRNA Mature ID miR-7111-3p

miRNA Sequence

AUCCUCUCUUCCCUCCUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-744 directly targets SLC4A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-744 miRNA Mature ID miR-744-3p

miRNA Sequence

CUGUUGCCACUAACCUCAACCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon57

miR-7853 directly targets SLC4A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7853 miRNA Mature ID miR-7853-5p

miRNA Sequence

UCAAAUGCAGAUCCUGACUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon58

miR-802 directly targets SLC4A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-802 miRNA Mature ID miR-802

miRNA Sequence

CAGUAACAAAGAUUCAUCCUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon59

miR-8055 directly targets SLC4A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8055 miRNA Mature ID miR-8055

miRNA Sequence

CUUUGAGCACAUGAGCAGACGGA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
3 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
5 DNA Methylation Dynamics in Urological Tumors.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
11 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
12 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
13 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.