Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0372 Transporter Info
Gene Name SLC46A1
Transporter Name Proton-coupled folate transporter
Gene ID
113235
UniProt ID
Q96NT5
Epigenetic Regulations of This DT (EGR)

Methylation

  Leukemia

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypermethylation of SLC46A1 in leukemia [ 1 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

 Down regulation ofSLC46A1 Experiment Method RT-qPCR

Studied Phenotype

 Leukemia[ ICD-11:2B33]

Experimental Material

 Multiple cell lines of human

Additional Notes

 SLC46A1 had increased methylation and decreased expression in pancreatic cancer.

  Mesothelioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypermethylation of SLC46A1 in mesothelioma [ 2 ]

Location

 Promoter (-309 to 104 bp)

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

 Down regulation ofSLC46A1 Experiment Method RT-qPCR

Studied Phenotype

 Mesothelioma[ ICD-11:2C26]

Experimental Material

 Multiple cell lines of human

Additional Notes

 Modulation of promoter methylation by 5-aza-2'-deoxycytidine may eradicate antifolate-resistant tumor cells displaying low SLC46A1 levels.

  Cervical cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Hypomethylation of SLC46A1 in cervical cancer (compare with antifolate-resistant counterpart cells) [ 3 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

 Down regulation ofSLC46A1 Experiment Method RT-qPCR

Studied Phenotype

 Cervical cancer[ ICD-11:2C77.Z]

Experimental Material

 Human cervical carcinoma cell line (Hela)

Additional Notes

 Hypermethylation of the human proton-coupled folate transporter (SLC46A1) minimal transcriptional regulatory region in an antifolate-resistant HeLa cell line.

  Prostate cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in prostate cancer [ 4 ]

Location

 5'UTR (cg13765368)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:3.93E+00 Statistic Test p-value:1.40E-02; Z-score:1.17E+01

Methylation in Case

 3.02E-01 (Median) Methylation in Control 7.69E-02 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in prostate cancer [ 4 ]

Location

 TSS1500 (cg23531340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:3.43E-02; Z-score:1.48E+00

Methylation in Case

 9.05E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in prostate cancer [ 4 ]

Location

 Body (cg26954464)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.21E+00 Statistic Test p-value:2.29E-03; Z-score:3.19E+00

Methylation in Case

 9.09E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in prostate cancer [ 4 ]

Location

 Body (cg02349468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.68E+00 Statistic Test p-value:3.84E-03; Z-score:-2.94E+00

Methylation in Case

 3.56E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in prostate cancer [ 4 ]

Location

 Body (cg12589308)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:1.12E-02; Z-score:2.54E+00

Methylation in Case

 9.50E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in prostate cancer [ 4 ]

Location

 Body (cg11017086)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.62E+00 Statistic Test p-value:3.96E-02; Z-score:-2.48E+00

Methylation in Case

 2.41E-01 (Median) Methylation in Control 3.91E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC46A1 in prostate cancer [ 4 ]

Location

 3'UTR (cg15090262)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:3.27E-03; Z-score:3.53E+00

Methylation in Case

 9.06E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in bladder cancer [ 5 ]

Location

 TSS1500 (cg27176697)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.67E+00 Statistic Test p-value:9.04E-07; Z-score:-6.18E+00

Methylation in Case

 4.95E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in bladder cancer [ 5 ]

Location

 TSS1500 (cg02062123)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.49E+00 Statistic Test p-value:4.32E-05; Z-score:-3.85E+00

Methylation in Case

 1.67E-01 (Median) Methylation in Control 2.49E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in bladder cancer [ 5 ]

Location

 TSS1500 (cg22436928)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.38E+00 Statistic Test p-value:3.53E-02; Z-score:-1.68E+00

Methylation in Case

 6.58E-02 (Median) Methylation in Control 9.08E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in bladder cancer [ 5 ]

Location

 TSS200 (cg23873654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.97E+00 Statistic Test p-value:3.30E-02; Z-score:-1.96E+00

Methylation in Case

 1.35E-02 (Median) Methylation in Control 2.67E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in bladder cancer [ 5 ]

Location

 Body (cg19822764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:2.37E-02; Z-score:-3.10E+00

Methylation in Case

 4.64E-01 (Median) Methylation in Control 5.59E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in bladder cancer [ 5 ]

Location

 Body (cg10762038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:4.65E-02; Z-score:-2.21E-01

Methylation in Case

 7.40E-01 (Median) Methylation in Control 7.43E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in breast cancer [ 6 ]

Location

 TSS1500 (cg27176697)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:1.36E-13; Z-score:1.56E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in breast cancer [ 6 ]

Location

 TSS1500 (cg02062123)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.38E+00 Statistic Test p-value:2.81E-09; Z-score:3.04E+00

Methylation in Case

 2.86E-01 (Median) Methylation in Control 2.07E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in breast cancer [ 6 ]

Location

 Body (cg21732844)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.56E+00 Statistic Test p-value:3.38E-27; Z-score:5.59E+00

Methylation in Case

 6.33E-01 (Median) Methylation in Control 4.06E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in breast cancer [ 6 ]

Location

 Body (cg04010423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.64E+00 Statistic Test p-value:7.23E-22; Z-score:4.75E+00

Methylation in Case

 5.26E-01 (Median) Methylation in Control 3.20E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in breast cancer [ 6 ]

Location

 Body (cg11351837)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.44E+00 Statistic Test p-value:2.95E-20; Z-score:3.54E+00

Methylation in Case

 6.29E-01 (Median) Methylation in Control 4.36E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in breast cancer [ 6 ]

Location

 Body (cg19822764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.38E+00 Statistic Test p-value:1.10E-12; Z-score:2.43E+00

Methylation in Case

 6.19E-01 (Median) Methylation in Control 4.50E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC46A1 in breast cancer [ 6 ]

Location

 Body (cg25910803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.35E+00 Statistic Test p-value:8.75E-09; Z-score:1.19E+00

Methylation in Case

 5.06E-01 (Median) Methylation in Control 3.75E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC46A1 in breast cancer [ 6 ]

Location

 Body (cg10762038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:2.84E-03; Z-score:-9.68E-01

Methylation in Case

 7.03E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in clear cell renal cell carcinoma [ 7 ]

Location

 TSS1500 (cg22436928)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.26E+00 Statistic Test p-value:1.50E-02; Z-score:7.02E-01

Methylation in Case

 4.35E-02 (Median) Methylation in Control 3.45E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in clear cell renal cell carcinoma [ 7 ]

Location

 TSS200 (cg23873654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:2.74E-04; Z-score:6.91E-01

Methylation in Case

 1.60E-02 (Median) Methylation in Control 1.47E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in clear cell renal cell carcinoma [ 7 ]

Location

 TSS200 (cg10405239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:4.10E-03; Z-score:4.79E-01

Methylation in Case

 2.43E-02 (Median) Methylation in Control 2.12E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in clear cell renal cell carcinoma [ 7 ]

Location

 Body (cg25910803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:2.55E-02; Z-score:1.29E+00

Methylation in Case

 5.42E-01 (Median) Methylation in Control 4.92E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 TSS1500 (cg02062123)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:3.56E-02; Z-score:4.28E-01

Methylation in Case

 2.39E-01 (Median) Methylation in Control 2.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 TSS200 (cg10405239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:1.70E-02; Z-score:-3.72E-01

Methylation in Case

 6.41E-02 (Median) Methylation in Control 6.84E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 1stExon (cg15612845)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:2.64E-02; Z-score:-4.75E-01

Methylation in Case

 3.44E-02 (Median) Methylation in Control 3.91E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg20818262)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.74E+00 Statistic Test p-value:2.59E-22; Z-score:-5.97E+00

Methylation in Case

 4.35E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg17343107)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.65E+00 Statistic Test p-value:2.96E-17; Z-score:-3.42E+00

Methylation in Case

 3.24E-01 (Median) Methylation in Control 5.35E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg24585559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.31E+00 Statistic Test p-value:5.53E-13; Z-score:-4.00E+00

Methylation in Case

 6.36E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg08535112)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.62E+00 Statistic Test p-value:4.05E-10; Z-score:-1.88E+00

Methylation in Case

 3.96E-01 (Median) Methylation in Control 6.43E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg09075844)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.30E+00 Statistic Test p-value:1.01E-09; Z-score:-1.80E+00

Methylation in Case

 3.64E-01 (Median) Methylation in Control 4.74E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg21732844)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:1.36E-07; Z-score:-1.25E+00

Methylation in Case

 3.92E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon10

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg04010423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.26E+00 Statistic Test p-value:1.74E-07; Z-score:-1.41E+00

Methylation in Case

 3.35E-01 (Median) Methylation in Control 4.23E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon11

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg19822764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:3.17E-07; Z-score:-1.33E+00

Methylation in Case

 4.78E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon12

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg11351837)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.21E+00 Statistic Test p-value:5.08E-07; Z-score:-1.52E+00

Methylation in Case

 4.10E-01 (Median) Methylation in Control 4.98E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon13

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg25910803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.18E+00 Statistic Test p-value:1.61E-06; Z-score:-1.02E+00

Methylation in Case

 3.85E-01 (Median) Methylation in Control 4.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon14

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 Body (cg10762038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:7.14E-05; Z-score:1.26E+00

Methylation in Case

 7.56E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon15

 Methylation of SLC46A1 in hepatocellular carcinoma [ 8 ]

Location

 3'UTR (cg05749559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.44E+00 Statistic Test p-value:3.82E-14; Z-score:-3.90E+00

Methylation in Case

 4.41E-01 (Median) Methylation in Control 6.33E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 TSS1500 (cg02062123)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:1.47E-04; Z-score:1.21E+00

Methylation in Case

 3.05E-01 (Median) Methylation in Control 2.57E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 TSS1500 (cg22436928)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.22E+00 Statistic Test p-value:4.22E-03; Z-score:1.17E+00

Methylation in Case

 1.17E-01 (Median) Methylation in Control 9.58E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 TSS200 (cg23873654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.72E+00 Statistic Test p-value:2.32E-03; Z-score:9.52E-01

Methylation in Case

 1.51E-02 (Median) Methylation in Control 8.78E-03 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 TSS200 (cg10405239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.20E+00 Statistic Test p-value:3.34E-02; Z-score:9.24E-01

Methylation in Case

 7.14E-02 (Median) Methylation in Control 5.94E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 Body (cg10762038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:1.25E-06; Z-score:-1.21E+00

Methylation in Case

 8.01E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 Body (cg21732844)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:6.02E-03; Z-score:3.99E-01

Methylation in Case

 9.19E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 Body (cg19822764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:6.40E-03; Z-score:8.64E-01

Methylation in Case

 9.36E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 Body (cg04010423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:7.16E-03; Z-score:7.82E-01

Methylation in Case

 8.71E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC46A1 in HIV infection [ 9 ]

Location

 Body (cg25910803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.00E+00 Statistic Test p-value:2.76E-02; Z-score:1.32E-01

Methylation in Case

 8.91E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in lung adenocarcinoma [ 10 ]

Location

 TSS1500 (cg02062123)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.15E+00 Statistic Test p-value:4.30E-02; Z-score:1.14E+00

Methylation in Case

 3.73E-01 (Median) Methylation in Control 3.25E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in lung adenocarcinoma [ 10 ]

Location

 1stExon (cg15612845)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:4.76E-02; Z-score:-8.26E-01

Methylation in Case

 5.02E-02 (Median) Methylation in Control 6.01E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in lung adenocarcinoma [ 10 ]

Location

 Body (cg11351837)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:1.67E-03; Z-score:1.86E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in lung adenocarcinoma [ 10 ]

Location

 Body (cg04010423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:5.58E-03; Z-score:1.76E+00

Methylation in Case

 7.07E-01 (Median) Methylation in Control 6.18E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in lung adenocarcinoma [ 10 ]

Location

 Body (cg25910803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:1.42E-02; Z-score:1.49E+00

Methylation in Case

 7.57E-01 (Median) Methylation in Control 6.81E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in lung adenocarcinoma [ 10 ]

Location

 Body (cg19822764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:2.00E-02; Z-score:1.68E+00

Methylation in Case

 8.19E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

 TSS1500 (cg11754206)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:3.62E-04; Z-score:4.29E-01

Methylation in Case

 3.26E-01 (Median) Methylation in Control 3.11E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in panic disorder [ 12 ]

Location

 TSS1500 (cg22436928)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-9.33E-01 Statistic Test p-value:1.66E-02; Z-score:-5.47E-01

Methylation in Case

 -4.22E+00 (Median) Methylation in Control -3.93E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in panic disorder [ 12 ]

Location

 Body (cg21732844)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:3.04E-02; Z-score:1.56E-01

Methylation in Case

 3.05E+00 (Median) Methylation in Control 2.97E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 TSS1500 (cg22436928)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:4.86E-02; Z-score:-3.12E-01

Methylation in Case

 7.04E-02 (Median) Methylation in Control 7.51E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 TSS200 (cg10405239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:4.22E-03; Z-score:6.22E-01

Methylation in Case

 5.09E-02 (Median) Methylation in Control 4.70E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 TSS200 (cg10923085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:5.17E-03; Z-score:-6.52E-01

Methylation in Case

 5.33E-02 (Median) Methylation in Control 5.90E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 1stExon (cg00497630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:2.57E-02; Z-score:2.84E-01

Methylation in Case

 8.74E-02 (Median) Methylation in Control 8.49E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 Body (cg25910803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:2.08E-06; Z-score:1.66E+00

Methylation in Case

 6.10E-01 (Median) Methylation in Control 5.43E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 Body (cg10762038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:3.63E-03; Z-score:-6.57E-01

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 Body (cg04010423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:8.12E-03; Z-score:6.67E-01

Methylation in Case

 5.60E-01 (Median) Methylation in Control 5.18E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 Body (cg21732977)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:8.54E-03; Z-score:-6.51E-01

Methylation in Case

 8.00E-02 (Median) Methylation in Control 8.55E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 Methylation of SLC46A1 in papillary thyroid cancer [ 13 ]

Location

 Body (cg11351837)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.98E-02; Z-score:9.28E-01

Methylation in Case

 6.75E-01 (Median) Methylation in Control 6.28E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in colon adenocarcinoma [ 14 ]

Location

 TSS200 (cg26763542)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:3.62E-03; Z-score:-1.49E+00

Methylation in Case

 6.97E-01 (Median) Methylation in Control 7.38E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in colon adenocarcinoma [ 14 ]

Location

 Body (cg07601645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:7.08E-05; Z-score:1.53E+00

Methylation in Case

 6.77E-01 (Median) Methylation in Control 6.15E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in colon adenocarcinoma [ 14 ]

Location

 Body (cg13617811)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.47E+00 Statistic Test p-value:6.64E-04; Z-score:-1.94E+00

Methylation in Case

 2.56E-01 (Median) Methylation in Control 3.76E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in colon adenocarcinoma [ 14 ]

Location

 Body (cg08094571)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:2.21E-03; Z-score:-1.67E+00

Methylation in Case

 3.37E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in colorectal cancer [ 15 ]

Location

 TSS200 (cg10405239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:1.81E-03; Z-score:7.33E-01

Methylation in Case

 9.52E-02 (Median) Methylation in Control 8.79E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in colorectal cancer [ 15 ]

Location

 1stExon (cg00497630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:4.67E-03; Z-score:9.50E-01

Methylation in Case

 1.10E-01 (Median) Methylation in Control 9.76E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in colorectal cancer [ 15 ]

Location

 1stExon (cg15612845)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:3.07E-02; Z-score:1.19E-01

Methylation in Case

 2.36E-02 (Median) Methylation in Control 2.31E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in colorectal cancer [ 15 ]

Location

 Body (cg25910803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.43E+00 Statistic Test p-value:3.25E-10; Z-score:2.61E+00

Methylation in Case

 7.14E-01 (Median) Methylation in Control 5.01E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in colorectal cancer [ 15 ]

Location

 Body (cg19822764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.26E+00 Statistic Test p-value:7.22E-07; Z-score:1.63E+00

Methylation in Case

 7.64E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in colorectal cancer [ 15 ]

Location

 Body (cg21732844)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:2.70E-05; Z-score:1.44E+00

Methylation in Case

 8.55E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC46A1 in colorectal cancer [ 15 ]

Location

 Body (cg11351837)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:1.41E-04; Z-score:1.09E+00

Methylation in Case

 8.37E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC46A1 in colorectal cancer [ 15 ]

Location

 Body (cg04010423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:8.52E-04; Z-score:7.71E-01

Methylation in Case

 7.32E-01 (Median) Methylation in Control 6.66E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in systemic lupus erythematosus [ 16 ]

Location

 TSS200 (cg23873654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:7.58E-03; Z-score:6.84E-02

Methylation in Case

 1.76E-02 (Median) Methylation in Control 1.69E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in systemic lupus erythematosus [ 16 ]

Location

 Body (cg21732977)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:1.03E-02; Z-score:3.33E-01

Methylation in Case

 2.98E-02 (Median) Methylation in Control 2.58E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in systemic lupus erythematosus [ 16 ]

Location

 Body (cg25910803)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:1.82E-02; Z-score:-1.50E-01

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in systemic lupus erythematosus [ 16 ]

Location

 Body (cg10762038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:4.17E-02; Z-score:-2.21E-01

Methylation in Case

 7.92E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC46A1 in atypical teratoid rhabdoid tumor [ 17 ]

Location

 1stExon (cg00497630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.85E+00 Statistic Test p-value:2.82E-34; Z-score:-5.11E+00

Methylation in Case

 4.62E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC46A1 in atypical teratoid rhabdoid tumor [ 17 ]

Location

 1stExon (cg15612845)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.34E+00 Statistic Test p-value:2.85E-18; Z-score:-3.87E+00

Methylation in Case

 7.09E-01 (Median) Methylation in Control 9.54E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC46A1 in atypical teratoid rhabdoid tumor [ 17 ]

Location

 1stExon (cg25014117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.31E+00 Statistic Test p-value:4.28E-16; Z-score:-2.20E+00

Methylation in Case

 6.22E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC46A1 in atypical teratoid rhabdoid tumor [ 17 ]

Location

 Body (cg04010423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:5.20E-04; Z-score:6.30E-01

Methylation in Case

 8.91E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC46A1 in atypical teratoid rhabdoid tumor [ 17 ]

Location

 Body (cg10762038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:1.77E-02; Z-score:2.03E-01

Methylation in Case

 1.36E-01 (Median) Methylation in Control 1.25E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC46A1 in atypical teratoid rhabdoid tumor [ 17 ]

Location

 Body (cg11351837)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.00E+00 Statistic Test p-value:2.15E-02; Z-score:6.18E-02

Methylation in Case

 8.99E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

microRNA

  B-cell acute lymphoblastic leukemia

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-595 downregulates SLC46A1 in B-cell acute lymphoblastic leukemia [ 18 ]

Epigenetic Type

 microRNA Experiment Method In-silico analysis

Related Molecular Changes

 Down regulation ofSLC46A1 Experiment Method Microarrays

miRNA Stemloop ID

 miR-595 miRNA Mature ID miR-595

miRNA Sequence

 GAAGUGUGCCGUGGUGUGUCU

miRNA Target Type

 Direct

Studied Phenotype

 B-cell acute lymphoblastic leukemia[ ICD-11:2A82]

Experimental Material

 Patient tissue samples

Additional Notes

 SNPs in miR-5189 that might affect SLC46A1 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL.

  Epigenetic Phenomenon2

 miR-5189 downregulates SLC46A1 in B-cell acute lymphoblastic leukemia [ 18 ]

Epigenetic Type

 microRNA Experiment Method In-silico analysis

miRNA Stemloop ID

 miR-5189 miRNA Mature ID miR-5189-5p

miRNA Sequence

 UCUGGGCACAGGCGGAUGGACAGG

miRNA Target Type

 Direct

Studied Phenotype

 B-cell acute lymphoblastic leukemia[ ICD-11:2A82]

Experimental Material

 Patient tissue samples

Additional Notes

 SNPs in miR-5189 that might affect SLC46A1 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL.

  Unclear Phenotype

          31 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-1238 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1238 miRNA Mature ID miR-1238-5p

miRNA Sequence

 GUGAGUGGGAGCCCCAGUGUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

 miR-130a directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-130a miRNA Mature ID miR-130a-3p

miRNA Sequence

 CAGUGCAAUGUUAAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

 miR-130b directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-130b miRNA Mature ID miR-130b-3p

miRNA Sequence

 CAGUGCAAUGAUGAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

 miR-138-1 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-138-1 miRNA Mature ID miR-138-1-3p

miRNA Sequence

 GCUACUUCACAACACCAGGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-18a directly targets SLC46A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-18a miRNA Mature ID miR-18a-3p

miRNA Sequence

 ACUGCCCUAAGUGCUCCUUCUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

 miR-1909 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1909 miRNA Mature ID miR-1909-5p

miRNA Sequence

 UGAGUGCCGGUGCCUGCCCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

 miR-19a directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

 UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

 miR-19b directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

 UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

 miR-301a directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-301a miRNA Mature ID miR-301a-3p

miRNA Sequence

 CAGUGCAAUAGUAUUGUCAAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

 miR-301b directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-301b miRNA Mature ID miR-301b-3p

miRNA Sequence

 CAGUGCAAUGAUAUUGUCAAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

 miR-3666 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3666 miRNA Mature ID miR-3666

miRNA Sequence

 CAGUGCAAGUGUAGAUGCCGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

 miR-3682 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3682 miRNA Mature ID miR-3682-5p

miRNA Sequence

 CUACUUCUACCUGUGUUAUCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-4295 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4295 miRNA Mature ID miR-4295

miRNA Sequence

 CAGUGCAAUGUUUUCCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

 miR-449b directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-449b miRNA Mature ID miR-449b-3p

miRNA Sequence

 CAGCCACAACUACCCUGCCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

 miR-4511 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4511 miRNA Mature ID miR-4511

miRNA Sequence

 GAAGAACUGUUGCAUUUGCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-454 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-454 miRNA Mature ID miR-454-3p

miRNA Sequence

 UAGUGCAAUAUUGCUUAUAGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

 miR-4658 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4658 miRNA Mature ID miR-4658

miRNA Sequence

 GUGAGUGUGGAUCCUGGAGGAAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

 miR-4713 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4713 miRNA Mature ID miR-4713-5p

miRNA Sequence

 UUCUCCCACUACCAGGCUCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon19

 miR-4758 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4758 miRNA Mature ID miR-4758-5p

miRNA Sequence

 GUGAGUGGGAGCCGGUGGGGCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

 miR-518a directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-518a miRNA Mature ID miR-518a-5p

miRNA Sequence

 CUGCAAAGGGAAGCCCUUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon21

 miR-527 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-527 miRNA Mature ID miR-527

miRNA Sequence

 CUGCAAAGGGAAGCCCUUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

 miR-561 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-561 miRNA Mature ID miR-561-3p

miRNA Sequence

 CAAAGUUUAAGAUCCUUGAAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon23

 miR-580 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-580 miRNA Mature ID miR-580-3p

miRNA Sequence

 UUGAGAAUGAUGAAUCAUUAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

 miR-629 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-629 miRNA Mature ID miR-629-3p

miRNA Sequence

 GUUCUCCCAACGUAAGCCCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon25

 miR-6790 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6790 miRNA Mature ID miR-6790-5p

miRNA Sequence

 GUGAGUGUGGAUUUGGCGGGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

 miR-6793 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6793 miRNA Mature ID miR-6793-3p

miRNA Sequence

 UCCCCAACCCCUGCCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon27

 miR-6814 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6814 miRNA Mature ID miR-6814-5p

miRNA Sequence

 UCCCAAGGGUGAGAUGCUGCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon28

 miR-6844 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6844 miRNA Mature ID miR-6844

miRNA Sequence

 UUCUUUGUUUUUAAUUCACAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

 miR-6867 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6867 miRNA Mature ID miR-6867-3p

miRNA Sequence

 CUCUCCCUCUUUACCCACUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon30

 miR-6895 directly targets SLC46A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6895 miRNA Mature ID miR-6895-5p

miRNA Sequence

 CAGGGCCAGGCACAGAGUAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon31

 miR-8081 directly targets SLC46A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8081 miRNA Mature ID miR-8081

miRNA Sequence

 CUUGAGUCGUGCCUUUCUGAAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells. Biochem Biophys Res Commun. 2008 Nov 28;376(4):787-92.
2 Role of proton-coupled folate transporter in pemetrexed resistance of mesothelioma: clinical evidence and new pharmacological tools. Ann Oncol. 2017 Nov 1;28(11):2725-2732.
3 Hypermethylation of the human proton-coupled folate transporter (SLC46A1) minimal transcriptional regulatory region in an antifolate-resistant HeLa cell line. Mol Cancer Ther. 2009 Aug;8(8):2424-31.
4 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
5 DNA Methylation Dynamics in Urological Tumors.
6 Genome-wide Scan for Methylation Profiles in Breast Cancer
7 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
8 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
16 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
17 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
18 MiR-pharmacogenetics of methotrexate in childhood B-cell acute lymphoblastic leukemia. Pharmacogenet Genomics. 2016 Nov;26(11):517-525.
19 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
20 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
21 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.