Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0370 Transporter Info
Gene Name	SLC45A3
Transporter Name	Solute carrier family 45 member 3
Gene ID	85414
UniProt ID	Q96JT2

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg01455178)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.01E-08; Z-score:-1.55E+00
Methylation in Case	7.41E-01 (Median)	Methylation in Control	8.42E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.60E+00	Statistic Test	p-value:1.46E-07; Z-score:-1.35E+00
Methylation in Case	3.21E-01 (Median)	Methylation in Control	5.14E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg10581876)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:1.98E-07; Z-score:1.20E+00
Methylation in Case	2.41E-01 (Median)	Methylation in Control	1.91E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg13323097)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:5.59E-07; Z-score:1.21E+00
Methylation in Case	8.96E-01 (Median)	Methylation in Control	7.16E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg13791589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:6.70E-07; Z-score:1.21E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	6.05E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg16278077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:1.70E-06; Z-score:-1.26E+00
Methylation in Case	4.19E-01 (Median)	Methylation in Control	6.03E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg17504096)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.35E+00	Statistic Test	p-value:1.96E-06; Z-score:1.19E+00
Methylation in Case	7.14E-01 (Median)	Methylation in Control	5.29E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg17723122)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-5.40E+00	Statistic Test	p-value:2.18E-06; Z-score:-1.45E+00
Methylation in Case	8.98E-02 (Median)	Methylation in Control	4.85E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg25551287)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:9.58E-06; Z-score:-9.02E-01
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg03374976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:2.96E-04; Z-score:7.99E-01
Methylation in Case	7.42E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg06832359)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.98E-03; Z-score:6.77E-01
Methylation in Case	7.06E-01 (Median)	Methylation in Control	6.26E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg12178904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.70E-02; Z-score:-3.94E-01
Methylation in Case	7.88E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg14084826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:4.26E-02; Z-score:-2.07E-01
Methylation in Case	1.15E-01 (Median)	Methylation in Control	1.24E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC45A3 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg12638776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:2.53E-11; Z-score:-2.11E+00
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.85E+00	Statistic Test	p-value:6.85E-08; Z-score:-1.24E+01
Methylation in Case	2.50E-01 (Median)	Methylation in Control	4.62E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	5'UTR (cg01455178)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.58E+00	Statistic Test	p-value:1.96E-06; Z-score:-7.37E+00
Methylation in Case	4.50E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	5'UTR (cg17723122)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.72E+00	Statistic Test	p-value:9.59E-06; Z-score:-5.43E+00
Methylation in Case	2.08E-01 (Median)	Methylation in Control	5.66E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	5'UTR (cg13791589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:3.58E-02; Z-score:-1.35E+00
Methylation in Case	2.02E-02 (Median)	Methylation in Control	2.67E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	TSS1500 (cg11455040)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:3.07E-02; Z-score:-1.37E+00
Methylation in Case	4.50E-02 (Median)	Methylation in Control	6.74E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	TSS200 (cg21850691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:6.90E-03; Z-score:-1.94E+00
Methylation in Case	5.40E-02 (Median)	Methylation in Control	6.47E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	TSS200 (cg12048674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.37E+00	Statistic Test	p-value:2.59E-02; Z-score:-1.64E+00
Methylation in Case	6.35E-02 (Median)	Methylation in Control	8.70E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	Body (cg06832359)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.73E+00	Statistic Test	p-value:1.04E-13; Z-score:-1.45E+01
Methylation in Case	3.22E-01 (Median)	Methylation in Control	5.58E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	Body (cg26894854)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:1.35E-07; Z-score:-6.01E+00
Methylation in Case	4.80E-01 (Median)	Methylation in Control	5.93E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	Body (cg27568165)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:8.51E-07; Z-score:-8.85E+00
Methylation in Case	4.11E-01 (Median)	Methylation in Control	6.52E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	Body (cg14084826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:4.07E-06; Z-score:-8.32E+00
Methylation in Case	6.21E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC45A3 in bladder cancer			[ 2 ]
Location	Body (cg12178904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:7.83E-05; Z-score:-6.10E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	7.14E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in breast cancer			[ 3 ]
Location	5'UTR (cg01455178)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:1.17E-22; Z-score:3.33E+00
Methylation in Case	7.34E-01 (Median)	Methylation in Control	5.37E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in breast cancer			[ 3 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:3.81E-16; Z-score:3.78E+00
Methylation in Case	5.53E-01 (Median)	Methylation in Control	4.12E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in breast cancer			[ 3 ]
Location	5'UTR (cg17723122)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:2.42E-07; Z-score:-1.31E+00
Methylation in Case	3.90E-01 (Median)	Methylation in Control	5.18E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in breast cancer			[ 3 ]
Location	5'UTR (cg10581876)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.19E-05; Z-score:-1.19E+00
Methylation in Case	8.32E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in breast cancer			[ 3 ]
Location	Body (cg27568165)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.73E-14; Z-score:2.10E+00
Methylation in Case	7.05E-01 (Median)	Methylation in Control	5.70E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC45A3 in breast cancer			[ 3 ]
Location	Body (cg14084826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.41E-10; Z-score:1.55E+00
Methylation in Case	7.58E-01 (Median)	Methylation in Control	6.96E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC45A3 in breast cancer			[ 3 ]
Location	Body (cg12178904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:1.76E-07; Z-score:1.35E+00
Methylation in Case	7.72E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC45A3 in breast cancer			[ 3 ]
Location	3'UTR (cg12638776)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:3.03E-07; Z-score:-7.78E-01
Methylation in Case	9.45E-02 (Median)	Methylation in Control	1.12E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.40E-03; Z-score:8.96E-01
Methylation in Case	4.20E-01 (Median)	Methylation in Control	3.85E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg01455178)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:1.56E-03; Z-score:2.56E+00
Methylation in Case	6.18E-01 (Median)	Methylation in Control	5.03E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg11961175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:1.45E-02; Z-score:5.79E-01
Methylation in Case	6.95E-02 (Median)	Methylation in Control	5.36E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg12178904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.28E-03; Z-score:-5.99E-01
Methylation in Case	9.02E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in colorectal cancer			[ 5 ]
Location	5'UTR (cg01455178)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:4.12E-02; Z-score:-2.64E-01
Methylation in Case	6.90E-01 (Median)	Methylation in Control	7.20E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg17284384)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.58E-02; Z-score:-2.11E-01
Methylation in Case	2.31E-02 (Median)	Methylation in Control	2.45E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in colorectal cancer			[ 5 ]
Location	Body (cg14084826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:5.85E-03; Z-score:-4.01E-01
Methylation in Case	8.97E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Depression	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in depression			[ 6 ]
Location	5'UTR (cg17504096)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.56E-02; Z-score:6.40E-01
Methylation in Case	5.50E-02 (Median)	Methylation in Control	5.13E-02 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in depression			[ 6 ]
Location	TSS1500 (cg11455040)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.78E-02; Z-score:5.02E-01
Methylation in Case	8.15E-02 (Median)	Methylation in Control	7.54E-02 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in depression			[ 6 ]
Location	TSS200 (cg00305188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:2.74E-02; Z-score:5.47E-01
Methylation in Case	7.64E-02 (Median)	Methylation in Control	7.21E-02 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg16278077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:3.82E-07; Z-score:7.14E-01
Methylation in Case	9.34E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg01455178)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.92E-06; Z-score:1.35E+00
Methylation in Case	5.33E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg10581876)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:2.03E-03; Z-score:-9.11E-01
Methylation in Case	4.66E-01 (Median)	Methylation in Control	5.65E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.18E-02; Z-score:2.28E-01
Methylation in Case	3.91E-01 (Median)	Methylation in Control	3.78E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg07061355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.68E+00	Statistic Test	p-value:2.11E-18; Z-score:-7.00E+00
Methylation in Case	4.60E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg13945442)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.45E+00	Statistic Test	p-value:7.84E-21; Z-score:-4.35E+00
Methylation in Case	4.05E-01 (Median)	Methylation in Control	5.89E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg00465739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.49E+00	Statistic Test	p-value:2.11E-16; Z-score:-2.32E+00
Methylation in Case	4.44E-01 (Median)	Methylation in Control	6.60E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg24121906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:3.28E-16; Z-score:-5.36E+00
Methylation in Case	5.50E-01 (Median)	Methylation in Control	7.94E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg13988611)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:2.47E-15; Z-score:-2.76E+00
Methylation in Case	4.80E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg26894854)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:6.37E-08; Z-score:1.45E+00
Methylation in Case	5.82E-01 (Median)	Methylation in Control	5.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg03374976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:6.16E-05; Z-score:7.54E-01
Methylation in Case	5.07E-01 (Median)	Methylation in Control	4.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg12178904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.71E-04; Z-score:1.04E+00
Methylation in Case	7.87E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC45A3 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg27568165)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.31E-02; Z-score:4.59E-01
Methylation in Case	7.49E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	5'UTR (cg01455178)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:2.28E-16; Z-score:2.38E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	7.49E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:7.36E-10; Z-score:2.38E+00
Methylation in Case	5.45E-01 (Median)	Methylation in Control	4.39E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	5'UTR (cg10581876)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.82E-03; Z-score:9.12E-01
Methylation in Case	8.96E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	5'UTR (cg17723122)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.53E-02; Z-score:-8.57E-01
Methylation in Case	7.18E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	TSS1500 (cg11961175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.43E+00	Statistic Test	p-value:6.98E-05; Z-score:1.52E+00
Methylation in Case	1.63E-01 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	TSS1500 (cg17284384)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.47E+00	Statistic Test	p-value:2.48E-03; Z-score:7.72E-01
Methylation in Case	1.61E-02 (Median)	Methylation in Control	1.10E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	TSS200 (cg12048674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:1.01E-03; Z-score:1.19E+00
Methylation in Case	7.40E-02 (Median)	Methylation in Control	5.74E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	Body (cg03374976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.25E-03; Z-score:-1.71E+00
Methylation in Case	6.54E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC45A3 in HIV infection			[ 8 ]
Location	Body (cg14084826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:2.31E-03; Z-score:4.35E-01
Methylation in Case	8.05E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg10581876)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:6.91E-03; Z-score:1.79E+00
Methylation in Case	8.79E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg02075570)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.76E+00	Statistic Test	p-value:4.26E-04; Z-score:-2.66E+00
Methylation in Case	7.77E-02 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg11455040)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.41E+00	Statistic Test	p-value:1.99E-03; Z-score:-1.83E+00
Methylation in Case	1.22E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg17284384)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.92E+00	Statistic Test	p-value:3.85E-03; Z-score:-1.94E+00
Methylation in Case	3.23E-02 (Median)	Methylation in Control	6.18E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg11961175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:9.68E-03; Z-score:-9.09E-01
Methylation in Case	1.95E-01 (Median)	Methylation in Control	2.39E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC45A3 in lung adenocarcinoma			[ 9 ]
Location	Body (cg03374976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:7.38E-03; Z-score:1.53E+00
Methylation in Case	6.00E-01 (Median)	Methylation in Control	5.16E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in panic disorder			[ 10 ]
Location	5'UTR (cg17723122)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:1.30E-03; Z-score:7.02E-01
Methylation in Case	1.59E+00 (Median)	Methylation in Control	1.35E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in panic disorder			[ 10 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.01E-01	Statistic Test	p-value:4.82E-02; Z-score:-3.47E-01
Methylation in Case	-8.60E-01 (Median)	Methylation in Control	-7.75E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg10581876)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.30E-05; Z-score:-1.06E+00
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.31E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg12048674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.69E-02; Z-score:4.02E-01
Methylation in Case	6.18E-02 (Median)	Methylation in Control	5.78E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in papillary thyroid cancer			[ 11 ]
Location	Body (cg12178904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.13E-05; Z-score:-8.58E-01
Methylation in Case	8.77E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in papillary thyroid cancer			[ 11 ]
Location	Body (cg26894854)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:5.22E-04; Z-score:1.58E+00
Methylation in Case	6.40E-01 (Median)	Methylation in Control	5.88E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in papillary thyroid cancer			[ 11 ]
Location	Body (cg03374976)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.93E-03; Z-score:8.37E-01
Methylation in Case	5.33E-01 (Median)	Methylation in Control	5.04E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC45A3 in papillary thyroid cancer			[ 11 ]
Location	Body (cg14084826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.46E-03; Z-score:-3.80E-01
Methylation in Case	8.24E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC45A3 in papillary thyroid cancer			[ 11 ]
Location	Body (cg27568165)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.69E-03; Z-score:-2.79E-01
Methylation in Case	8.16E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in systemic lupus erythematosus			[ 12 ]
Location	5'UTR (cg08639339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.41E-03; Z-score:3.49E-01
Methylation in Case	6.58E-01 (Median)	Methylation in Control	6.17E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in systemic lupus erythematosus			[ 12 ]
Location	5'UTR (cg13323097)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:5.39E-03; Z-score:1.73E-01
Methylation in Case	1.83E-01 (Median)	Methylation in Control	1.78E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in systemic lupus erythematosus			[ 12 ]
Location	5'UTR (cg01455178)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:3.43E-02; Z-score:2.64E-01
Methylation in Case	8.84E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in systemic lupus erythematosus			[ 12 ]
Location	5'UTR (cg13791589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:4.11E-02; Z-score:-1.04E-01
Methylation in Case	2.97E-02 (Median)	Methylation in Control	3.08E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in systemic lupus erythematosus			[ 12 ]
Location	TSS1500 (cg17284384)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:5.52E-04; Z-score:1.92E-01
Methylation in Case	1.84E-02 (Median)	Methylation in Control	1.71E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC45A3 in systemic lupus erythematosus			[ 12 ]
Location	Body (cg14084826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.99E-02; Z-score:-1.85E-01
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in colon adenocarcinoma			[ 13 ]
Location	TSS1500 (cg23909013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.79E+00	Statistic Test	p-value:2.58E-04; Z-score:3.48E+00
Methylation in Case	3.39E-01 (Median)	Methylation in Control	1.90E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in colon adenocarcinoma			[ 13 ]
Location	TSS200 (cg00111823)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.13E-03; Z-score:-1.41E+00
Methylation in Case	9.41E-01 (Median)	Methylation in Control	9.50E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in colon adenocarcinoma			[ 13 ]
Location	TSS200 (cg19766441)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.27E+00	Statistic Test	p-value:2.17E-03; Z-score:2.22E+00
Methylation in Case	2.60E-01 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in colon adenocarcinoma			[ 13 ]
Location	Body (cg15526153)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.77E-04; Z-score:-2.05E+00
Methylation in Case	7.67E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in pancretic ductal adenocarcinoma			[ 14 ]
Location	TSS1500 (cg20982412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:4.87E-20; Z-score:4.79E+00
Methylation in Case	4.20E-01 (Median)	Methylation in Control	3.22E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in pancretic ductal adenocarcinoma			[ 14 ]
Location	TSS1500 (cg13948585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.89E+00	Statistic Test	p-value:8.15E-18; Z-score:3.56E+00
Methylation in Case	2.94E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in pancretic ductal adenocarcinoma			[ 14 ]
Location	TSS200 (cg12005098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.29E+00	Statistic Test	p-value:1.15E-21; Z-score:3.76E+00
Methylation in Case	1.43E-01 (Median)	Methylation in Control	6.23E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in pancretic ductal adenocarcinoma			[ 14 ]
Location	Body (cg25253677)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.47E+00	Statistic Test	p-value:3.24E-09; Z-score:1.33E+00
Methylation in Case	1.59E-01 (Median)	Methylation in Control	6.46E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC45A3 in pancretic ductal adenocarcinoma			[ 14 ]
Location	3'UTR (cg19877765)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:3.70E-02; Z-score:-1.06E+00
Methylation in Case	4.39E-01 (Median)	Methylation in Control	4.82E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC45A3 in prostate cancer			[ 15 ]
Location	TSS1500 (cg05671585)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.69E+00	Statistic Test	p-value:9.42E-03; Z-score:3.69E+00
Methylation in Case	5.16E-02 (Median)	Methylation in Control	3.04E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC45A3 in prostate cancer			[ 15 ]
Location	TSS200 (cg00881552)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:3.00E-03; Z-score:3.77E+00
Methylation in Case	1.35E-01 (Median)	Methylation in Control	1.16E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC45A3 in prostate cancer			[ 15 ]
Location	TSS200 (cg21636683)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:7.27E-03; Z-score:2.98E+00
Methylation in Case	8.00E-01 (Median)	Methylation in Control	6.00E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC45A3 in prostate cancer			[ 15 ]
Location	Body (cg21644011)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.40E-02; Z-score:2.02E+00
Methylation in Case	9.26E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-218 directly targets SLC45A3			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-218	miRNA Mature ID	miR-218-5p
miRNA Sequence	UUGUGCUUGAUCUAACCAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
15	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16	MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence