General Information of Drug Transporter (DT)
DT ID DTD0364 Transporter Info
Gene Name SLC44A2
Transporter Name Choline transporter-like protein 2
Gene ID
57153
UniProt ID
Q8IWA5
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in bladder cancer [ 1 ]

Location

TSS1500 (cg26489057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:3.44E-02; Z-score:2.52E+00

Methylation in Case

2.28E-01 (Median) Methylation in Control 1.88E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in bladder cancer [ 1 ]

Location

Body (cg06943912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.92E+00 Statistic Test p-value:5.56E-13; Z-score:-1.22E+01

Methylation in Case

1.61E-01 (Median) Methylation in Control 6.30E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC44A2 in bladder cancer [ 1 ]

Location

Body (cg08275454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:5.20E-04; Z-score:-2.67E+00

Methylation in Case

7.80E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in breast cancer [ 2 ]

Location

TSS1500 (cg26489057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.12E+00 Statistic Test p-value:1.53E-14; Z-score:4.29E+00

Methylation in Case

3.66E-01 (Median) Methylation in Control 1.73E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in breast cancer [ 2 ]

Location

TSS1500 (cg19392998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.29E+00 Statistic Test p-value:3.57E-12; Z-score:2.94E+00

Methylation in Case

2.35E-01 (Median) Methylation in Control 1.03E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC44A2 in breast cancer [ 2 ]

Location

Body (cg06943912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.37E+00 Statistic Test p-value:7.32E-11; Z-score:-2.11E+00

Methylation in Case

4.27E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC44A2 in breast cancer [ 2 ]

Location

Body (cg08275454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.90E-05; Z-score:-9.00E-01

Methylation in Case

8.03E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC44A2 in breast cancer [ 2 ]

Location

Body (cg11345505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.99E+00 Statistic Test p-value:3.47E-04; Z-score:-1.68E+00

Methylation in Case

1.04E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg26489057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:4.25E-02; Z-score:-7.35E-01

Methylation in Case

3.29E-01 (Median) Methylation in Control 3.75E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg12156831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.76E-03; Z-score:5.19E-01

Methylation in Case

1.46E-02 (Median) Methylation in Control 1.39E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in colorectal cancer [ 4 ]

Location

TSS1500 (cg14792002)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.17E-02; Z-score:-6.70E-01

Methylation in Case

8.90E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in colorectal cancer [ 4 ]

Location

Body (cg06943912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.64E+00 Statistic Test p-value:7.19E-12; Z-score:-2.89E+00

Methylation in Case

4.20E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC44A2 in colorectal cancer [ 4 ]

Location

Body (cg08275454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:8.85E-08; Z-score:-2.90E+00

Methylation in Case

8.82E-01 (Median) Methylation in Control 9.20E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC44A2 in colorectal cancer [ 4 ]

Location

Body (cg01247891)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.40E-02; Z-score:3.75E-01

Methylation in Case

1.45E-01 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in HIV infection [ 5 ]

Location

TSS1500 (cg19392998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:2.64E-03; Z-score:7.06E-01

Methylation in Case

2.05E-01 (Median) Methylation in Control 1.63E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in HIV infection [ 5 ]

Location

Body (cg06943912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.43E+00 Statistic Test p-value:1.06E-09; Z-score:5.63E+00

Methylation in Case

3.38E-01 (Median) Methylation in Control 9.87E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC44A2 in HIV infection [ 5 ]

Location

Body (cg08275454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.51E-04; Z-score:-1.05E+00

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC44A2 in HIV infection [ 5 ]

Location

Body (cg01247891)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.04E-03; Z-score:9.92E-01

Methylation in Case

9.13E-02 (Median) Methylation in Control 7.74E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC44A2 in HIV infection [ 5 ]

Location

Body (cg15503663)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:7.27E-03; Z-score:7.25E-01

Methylation in Case

1.23E-02 (Median) Methylation in Control 9.60E-03 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC44A2 in HIV infection [ 5 ]

Location

Body (cg11345505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:3.66E-02; Z-score:8.48E-01

Methylation in Case

6.64E-02 (Median) Methylation in Control 5.37E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg26489057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:7.10E-03; Z-score:1.04E+00

Methylation in Case

3.96E-01 (Median) Methylation in Control 3.34E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg19392998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:3.95E-02; Z-score:6.05E-01

Methylation in Case

2.54E-01 (Median) Methylation in Control 2.31E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

Body (cg11345505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.18E-04; Z-score:-9.35E-01

Methylation in Case

4.73E-01 (Median) Methylation in Control 5.34E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

Body (cg08275454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.10E-04; Z-score:-9.10E-01

Methylation in Case

9.02E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC44A2 in papillary thyroid cancer [ 6 ]

Location

Body (cg01247891)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.28E-04; Z-score:-7.18E-01

Methylation in Case

5.85E-02 (Median) Methylation in Control 6.48E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in systemic lupus erythematosus [ 7 ]

Location

TSS200 (cg05567294)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.52E-02; Z-score:-1.44E-01

Methylation in Case

1.85E-01 (Median) Methylation in Control 1.95E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in systemic lupus erythematosus [ 7 ]

Location

Body (cg15503663)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.19E-02; Z-score:-1.18E-01

Methylation in Case

1.08E-02 (Median) Methylation in Control 1.12E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

Body (cg01247891)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:5.68E-05; Z-score:-1.02E+00

Methylation in Case

4.99E-01 (Median) Methylation in Control 6.19E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

Body (cg06943912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:3.09E-03; Z-score:2.31E-01

Methylation in Case

8.17E-02 (Median) Methylation in Control 6.68E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

Body (cg08275454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:5.64E-03; Z-score:7.08E-01

Methylation in Case

8.28E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

Body (cg11345505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:2.14E-02; Z-score:-1.32E-01

Methylation in Case

2.94E-02 (Median) Methylation in Control 3.33E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC44A2 in atypical teratoid rhabdoid tumor [ 8 ]

Location

Body (cg12156831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.68E-02; Z-score:-6.74E-02

Methylation in Case

1.34E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Colon cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in colon adenocarcinoma [ 9 ]

Location

Body (cg01550915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:4.48E-04; Z-score:-3.31E+00

Methylation in Case

7.36E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in depression [ 10 ]

Location

Body (cg11345505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.22E-02; Z-score:-2.19E-01

Methylation in Case

6.05E-02 (Median) Methylation in Control 6.28E-02 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

Body (cg08275454)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:6.14E-09; Z-score:-1.73E+00

Methylation in Case

6.79E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

Body (cg11345505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:7.82E-06; Z-score:1.29E+00

Methylation in Case

5.27E-01 (Median) Methylation in Control 3.94E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

Body (cg01247891)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.97E-03; Z-score:2.31E-02

Methylation in Case

8.64E-02 (Median) Methylation in Control 8.58E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

Body (cg15503663)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:6.75E-03; Z-score:-2.86E-02

Methylation in Case

2.43E-02 (Median) Methylation in Control 2.47E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC44A2 in hepatocellular carcinoma [ 11 ]

Location

Body (cg12156831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.52E-02; Z-score:4.05E-02

Methylation in Case

2.17E-02 (Median) Methylation in Control 2.13E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in pancretic ductal adenocarcinoma [ 12 ]

Location

Body (cg17836790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.24E-08; Z-score:1.30E+00

Methylation in Case

6.00E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in pancretic ductal adenocarcinoma [ 12 ]

Location

Body (cg02614661)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:9.12E-06; Z-score:-1.28E+00

Methylation in Case

7.82E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in panic disorder [ 13 ]

Location

Body (cg06943912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-9.68E-01 Statistic Test p-value:8.12E-03; Z-score:-2.23E-01

Methylation in Case

-4.24E+00 (Median) Methylation in Control -4.10E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Prostate cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC44A2 in prostate cancer [ 14 ]

Location

Body (cg25543755)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:8.77E-04; Z-score:3.94E+00

Methylation in Case

7.43E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC44A2 in prostate cancer [ 14 ]

Location

Body (cg18949702)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:9.32E-03; Z-score:2.57E+00

Methylation in Case

9.02E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC44A2 in prostate cancer [ 14 ]

Location

Body (cg15035421)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.39E+00 Statistic Test p-value:1.56E-02; Z-score:-8.15E+00

Methylation in Case

2.83E-01 (Median) Methylation in Control 3.94E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC44A2 in prostate cancer [ 14 ]

Location

3'UTR (cg08094280)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.20E-02; Z-score:2.40E+00

Methylation in Case

9.19E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Brain neuroepithelial tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC44A2 in brain neuroepithelial tumour than that in healthy individual

Studied Phenotype

Brain neuroepithelial tumour [ICD-11:2A00.2Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.71E-10; Fold-change:-0.259907327; Z-score:-0.985386494
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Vestibular melanotic schwannoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC44A2 in vestibular melanotic schwannoma than that in healthy individual

Studied Phenotype

Vestibular melanotic schwannoma [ICD-11:2A02.3]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.046576913; Fold-change:-0.216972363; Z-score:-1.447537479
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-124 directly targets SLC44A2 [ 15 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
9 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
10 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
11 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
12 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.