Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0363 Transporter Info
Gene Name SLC44A1
Transporter Name Choline transporter-like protein 1
Gene ID
23446
UniProt ID
Q8WWI5
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg10133725)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.31E+00 Statistic Test p-value:1.43E-08; Z-score:-1.45E+00

Methylation in Case

 5.40E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC44A1 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg10652277)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:2.14E-02; Z-score:-3.02E-01

Methylation in Case

 4.36E-02 (Median) Methylation in Control 4.54E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in papillary thyroid cancer [ 2 ]

Location

 TSS1500 (cg19287114)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:2.24E-03; Z-score:-1.02E+00

Methylation in Case

 5.44E-02 (Median) Methylation in Control 6.29E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in breast cancer [ 3 ]

Location

 TSS200 (cg24178533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:4.44E-02; Z-score:5.43E-01

Methylation in Case

 6.93E-02 (Median) Methylation in Control 6.10E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC44A1 in breast cancer [ 3 ]

Location

 Body (cg14504440)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.22E+00 Statistic Test p-value:1.31E-15; Z-score:1.92E+00

Methylation in Case

 7.38E-01 (Median) Methylation in Control 6.03E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC44A1 in breast cancer [ 3 ]

Location

 Body (cg13603332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.23E+00 Statistic Test p-value:1.48E-09; Z-score:-2.23E+00

Methylation in Case

 4.87E-01 (Median) Methylation in Control 6.00E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC44A1 in breast cancer [ 3 ]

Location

 Body (cg13889369)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.26E+00 Statistic Test p-value:1.88E-05; Z-score:9.69E-01

Methylation in Case

 7.11E-02 (Median) Methylation in Control 5.65E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in atypical teratoid rhabdoid tumor [ 4 ]

Location

 Body (cg13603332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:3.76E-02; Z-score:4.94E-01

Methylation in Case

 8.89E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC44A1 in atypical teratoid rhabdoid tumor [ 4 ]

Location

 Body (cg13889369)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.22E+00 Statistic Test p-value:3.96E-02; Z-score:-8.29E-01

Methylation in Case

 3.93E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC44A1 in atypical teratoid rhabdoid tumor [ 4 ]

Location

 Body (cg14504440)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.34E+00 Statistic Test p-value:4.66E-02; Z-score:1.10E+00

Methylation in Case

 4.35E-01 (Median) Methylation in Control 3.25E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in bladder cancer [ 5 ]

Location

 Body (cg13603332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.00E+00 Statistic Test p-value:5.41E-11; Z-score:-1.54E+01

Methylation in Case

 3.02E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in colorectal cancer [ 6 ]

Location

 Body (cg13603332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:3.74E-08; Z-score:-2.71E+00

Methylation in Case

 6.15E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC44A1 in colorectal cancer [ 6 ]

Location

 Body (cg14504440)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:9.81E-03; Z-score:-6.59E-01

Methylation in Case

 9.30E-01 (Median) Methylation in Control 9.40E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg04958882)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.76E+00 Statistic Test p-value:2.72E-20; Z-score:-9.60E+00

Methylation in Case

 4.39E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in HIV infection [ 8 ]

Location

 Body (cg13603332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.62E+00 Statistic Test p-value:3.86E-08; Z-score:3.75E+00

Methylation in Case

 6.23E-01 (Median) Methylation in Control 3.85E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC44A1 in HIV infection [ 8 ]

Location

 Body (cg13889369)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.39E+00 Statistic Test p-value:5.63E-06; Z-score:1.59E+00

Methylation in Case

 1.13E-01 (Median) Methylation in Control 8.11E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in lung adenocarcinoma [ 9 ]

Location

 Body (cg13603332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.31E+00 Statistic Test p-value:2.29E-03; Z-score:2.32E+00

Methylation in Case

 5.93E-01 (Median) Methylation in Control 4.52E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in panic disorder [ 10 ]

Location

 Body (cg13603332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-6.51E-01 Statistic Test p-value:2.93E-05; Z-score:-8.62E-01

Methylation in Case

 -1.50E+00 (Median) Methylation in Control -9.78E-01 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC44A1 in prostate cancer [ 11 ]

Location

 Body (cg05740959)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:4.94E+00 Statistic Test p-value:8.11E-03; Z-score:5.84E+01

Methylation in Case

 6.40E-01 (Median) Methylation in Control 1.30E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC44A1 in prostate cancer [ 11 ]

Location

 Body (cg13013644)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.18E+00 Statistic Test p-value:3.07E-02; Z-score:7.95E+00

Methylation in Case

 8.30E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          40 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 let-7a-2 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7a-2 miRNA Mature ID let-7a-2-3p

miRNA Sequence

 CUGUACAGCCUCCUAGCUUUCC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon2

 let-7c directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-3p

miRNA Sequence

 CUGUACAACCUUCUAGCUUUCC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon3

 let-7g directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 let-7g miRNA Mature ID let-7g-3p

miRNA Sequence

 CUGUACAGGCCACUGCCUUGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon4

 miR-1-3p directly targets SLC44A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-1-3p miRNA Mature ID miR-1-3p

miRNA Sequence

 UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon5

 miR-1197 directly targets SLC44A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1197 miRNA Mature ID miR-1197

miRNA Sequence

 UAGGACACAUGGUCUACUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-122 directly targets SLC44A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

 UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon7

 miR-124 directly targets SLC44A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon8

 miR-1283 directly targets SLC44A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1283 miRNA Mature ID miR-1283

miRNA Sequence

 UCUACAAAGGAAAGCGCUUUCU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon9

 miR-129 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

 CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon10

 miR-130b directly targets SLC44A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-130b miRNA Mature ID miR-130b-3p

miRNA Sequence

 CAGUGCAAUGAUGAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

 miR-186 directly targets SLC44A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-5p

miRNA Sequence

 CAAAGAAUUCUCCUUUUGGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-19b directly targets SLC44A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

 UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

 miR-203a directly targets SLC44A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-203a miRNA Mature ID miR-203a-3p

miRNA Sequence

 GUGAAAUGUUUAGGACCACUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon14

 miR-2681 directly targets SLC44A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2681 miRNA Mature ID miR-2681-5p

miRNA Sequence

 GUUUUACCACCUCCAGGAGACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon15

 miR-3133 directly targets SLC44A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3133 miRNA Mature ID miR-3133

miRNA Sequence

 UAAAGAACUCUUAAAACCCAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-3156 directly targets SLC44A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3156 miRNA Mature ID miR-3156-5p

miRNA Sequence

 AAAGAUCUGGAAGUGGGAGACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon17

 miR-3185 directly targets SLC44A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3185 miRNA Mature ID miR-3185

miRNA Sequence

 AGAAGAAGGCGGUCGGUCUGCGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon18

 miR-329 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon19

 miR-362 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon20

 miR-3646 directly targets SLC44A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3646 miRNA Mature ID miR-3646

miRNA Sequence

 AAAAUGAAAUGAGCCCAGCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon21

 miR-3675 directly targets SLC44A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3675 miRNA Mature ID miR-3675-3p

miRNA Sequence

 CAUCUCUAAGGAACUCCCCCAA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon22

 miR-3941 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon23

 miR-4311 directly targets SLC44A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4311 miRNA Mature ID miR-4311

miRNA Sequence

 GAAAGAGAGCUGAGUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon24

 miR-4436a directly targets SLC44A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4436a miRNA Mature ID miR-4436a

miRNA Sequence

 GCAGGACAGGCAGAAGUGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon25

 miR-4668 directly targets SLC44A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4668 miRNA Mature ID miR-4668-5p

miRNA Sequence

 AGGGAAAAAAAAAAGGAUUUGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon26

 miR-4684 directly targets SLC44A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4684 miRNA Mature ID miR-4684-5p

miRNA Sequence

 CUCUCUACUGACUUGCAACAUA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon27

 miR-4789 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

 CACACAUAGCAGGUGUAUAUA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon28

 miR-4797 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4797 miRNA Mature ID miR-4797-5p

miRNA Sequence

 GACAGAGUGCCACUUACUGAA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon29

 miR-493 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-493 miRNA Mature ID miR-493-5p

miRNA Sequence

 UUGUACAUGGUAGGCUUUCAUU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon30

 miR-5000 directly targets SLC44A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5000 miRNA Mature ID miR-5000-3p

miRNA Sequence

 UCAGGACACUUCUGAACUUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon31

 miR-545 directly targets SLC44A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-545 miRNA Mature ID miR-545-5p

miRNA Sequence

 UCAGUAAAUGUUUAUUAGAUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon32

 miR-5695 directly targets SLC44A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5695 miRNA Mature ID miR-5695

miRNA Sequence

 ACUCCAAGAAGAAUCUAGACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon33

 miR-603 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon34

 miR-651 directly targets SLC44A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-651 miRNA Mature ID miR-651-3p

miRNA Sequence

 AAAGGAAAGUGUAUCCUAAAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon35

 miR-6809 directly targets SLC44A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6809 miRNA Mature ID miR-6809-5p

miRNA Sequence

 UGGCAAGGAAAGAAGAGGAUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon36

 miR-6830 directly targets SLC44A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6830 miRNA Mature ID miR-6830-5p

miRNA Sequence

 CCAAGGAAGGAGGCUGGACAUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon37

 miR-6865 directly targets SLC44A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6865 miRNA Mature ID miR-6865-3p

miRNA Sequence

 ACACCCUCUUUCCCUACCGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon38

 miR-7161 directly targets SLC44A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7161 miRNA Mature ID miR-7161-3p

miRNA Sequence

 UAGAUCUUUGACUCUGGCAGUCUCCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon39

 miR-8485 directly targets SLC44A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon40

 miR-875 directly targets SLC44A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-875 miRNA Mature ID miR-875-5p

miRNA Sequence

 UAUACCUCAGUUUUAUCAGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
5 DNA Methylation Dynamics in Urological Tumors.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
13 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
14 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
15 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
16 Argonaute CLIP Defines a Deregulated miR-122-Bound Transcriptome that Correlates with Patient Survival in Human Liver Cancer. Mol Cell. 2017 Aug 3;67(3):400-410.e7.
17 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
18 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
19 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
20 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
21 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.