General Information of Drug Transporter (DT)
DT ID DTD0360 Transporter Info
Gene Name SLC43A1
Transporter Name L-type amino acid transporter 3
Gene ID
8501
UniProt ID
O75387
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg07764959)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.31E-07; Z-score:-1.10E+00

Methylation in Case

9.04E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg08572535)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:1.41E-07; Z-score:1.42E+00

Methylation in Case

9.24E-01 (Median) Methylation in Control 6.84E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.67E-05; Z-score:6.62E-01

Methylation in Case

8.65E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg02680086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.03E-04; Z-score:-1.05E+00

Methylation in Case

7.51E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg04431596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:7.45E-04; Z-score:-1.30E+00

Methylation in Case

4.08E-01 (Median) Methylation in Control 5.28E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg09478995)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.06E-02; Z-score:6.65E-01

Methylation in Case

7.52E-01 (Median) Methylation in Control 6.54E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg10964211)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.95E-02; Z-score:6.04E-01

Methylation in Case

8.60E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg11376147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.19E-02; Z-score:5.34E-01

Methylation in Case

4.22E-01 (Median) Methylation in Control 3.70E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg12619347)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.85E-02; Z-score:-4.23E-01

Methylation in Case

8.29E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

3'UTR (cg09888840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.49E+00 Statistic Test p-value:1.49E-12; Z-score:-2.42E+00

Methylation in Case

4.63E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Breast cancer

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

5'UTR (cg08572535)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:9.62E-06; Z-score:1.04E+00

Methylation in Case

1.01E-01 (Median) Methylation in Control 8.19E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

TSS1500 (cg26624118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:2.86E-04; Z-score:8.08E-01

Methylation in Case

8.80E-02 (Median) Methylation in Control 7.43E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

TSS1500 (cg05375277)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.47E+00 Statistic Test p-value:1.93E-02; Z-score:5.56E-01

Methylation in Case

9.34E-03 (Median) Methylation in Control 6.34E-03 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

TSS200 (cg14028489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:3.30E-02; Z-score:3.94E-01

Methylation in Case

5.21E-03 (Median) Methylation in Control 3.62E-03 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg23075364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.64E+00 Statistic Test p-value:4.73E-25; Z-score:6.51E+00

Methylation in Case

5.13E-01 (Median) Methylation in Control 1.94E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.86E+00 Statistic Test p-value:5.92E-22; Z-score:4.03E+00

Methylation in Case

5.80E-01 (Median) Methylation in Control 3.11E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg02680086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.10E+00 Statistic Test p-value:7.28E-21; Z-score:5.94E+00

Methylation in Case

4.57E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg26418434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.12E+00 Statistic Test p-value:9.07E-20; Z-score:4.05E+00

Methylation in Case

4.46E-01 (Median) Methylation in Control 2.10E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.60E+00 Statistic Test p-value:4.19E-19; Z-score:3.27E+00

Methylation in Case

4.34E-01 (Median) Methylation in Control 2.71E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg11376147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:8.78E-18; Z-score:-2.95E+00

Methylation in Case

2.26E-01 (Median) Methylation in Control 2.97E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg25284762)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:2.82E-15; Z-score:4.14E+00

Methylation in Case

6.10E-01 (Median) Methylation in Control 4.57E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg12619347)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:2.74E-11; Z-score:-2.83E+00

Methylation in Case

4.87E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:1.76E-07; Z-score:1.09E+00

Methylation in Case

5.93E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg04431596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:5.43E-07; Z-score:-1.43E+00

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg17559156)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:6.87E-05; Z-score:-1.12E+00

Methylation in Case

6.36E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

Body (cg09478995)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.98E-02; Z-score:-4.50E-01

Methylation in Case

6.54E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC43A1 in breast cancer [ 2 ]

Location

3'UTR (cg09888840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.22E-03; Z-score:-8.75E-01

Methylation in Case

7.77E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

5'UTR (cg08572535)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:3.67E-05; Z-score:1.88E+00

Methylation in Case

7.50E-02 (Median) Methylation in Control 5.50E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

5'UTR (cg07764959)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:6.94E-03; Z-score:5.63E-01

Methylation in Case

2.08E-02 (Median) Methylation in Control 1.88E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg26624118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:8.22E-03; Z-score:1.21E+00

Methylation in Case

3.00E-02 (Median) Methylation in Control 2.35E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg05375277)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:8.54E-03; Z-score:8.60E-01

Methylation in Case

1.52E-02 (Median) Methylation in Control 1.38E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

TSS200 (cg02037518)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:9.32E-03; Z-score:6.75E-01

Methylation in Case

1.75E-02 (Median) Methylation in Control 1.65E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

TSS200 (cg17057783)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.85E-02; Z-score:4.39E-01

Methylation in Case

2.89E-02 (Median) Methylation in Control 2.66E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

TSS200 (cg23409370)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.02E-02; Z-score:2.17E-01

Methylation in Case

2.52E-02 (Median) Methylation in Control 2.41E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg25284762)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:1.06E-09; Z-score:4.10E+00

Methylation in Case

7.22E-01 (Median) Methylation in Control 5.66E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg02680086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.37E+00 Statistic Test p-value:1.19E-06; Z-score:1.70E+00

Methylation in Case

1.76E-01 (Median) Methylation in Control 7.43E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg23075364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.04E+00 Statistic Test p-value:1.96E-06; Z-score:1.47E+00

Methylation in Case

2.46E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.55E+00 Statistic Test p-value:3.80E-06; Z-score:1.50E+00

Methylation in Case

3.56E-01 (Median) Methylation in Control 2.29E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.40E+00 Statistic Test p-value:6.19E-06; Z-score:1.44E+00

Methylation in Case

3.82E-01 (Median) Methylation in Control 2.74E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.31E-02; Z-score:1.28E+00

Methylation in Case

6.86E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC43A1 in clear cell renal cell carcinoma [ 3 ]

Location

3'UTR (cg09888840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.02E-05; Z-score:-1.58E+00

Methylation in Case

9.27E-01 (Median) Methylation in Control 9.55E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

5'UTR (cg00162231)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.43E+00 Statistic Test p-value:1.46E-06; Z-score:1.81E+00

Methylation in Case

5.81E-01 (Median) Methylation in Control 4.07E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

5'UTR (cg15374686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:1.08E-03; Z-score:1.86E+00

Methylation in Case

6.23E-01 (Median) Methylation in Control 5.24E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

5'UTR (cg18003231)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.29E-03; Z-score:5.10E-01

Methylation in Case

8.89E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

TSS1500 (cg05331214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.69E+00 Statistic Test p-value:7.16E-08; Z-score:-8.23E+00

Methylation in Case

4.00E-01 (Median) Methylation in Control 6.78E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

TSS1500 (cg09456905)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:2.17E-06; Z-score:-2.27E+00

Methylation in Case

5.06E-01 (Median) Methylation in Control 6.24E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

TSS1500 (cg09432234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.26E-03; Z-score:-1.01E+00

Methylation in Case

1.20E-01 (Median) Methylation in Control 1.47E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

TSS200 (cg13188098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:1.72E-05; Z-score:1.88E+00

Methylation in Case

4.21E-01 (Median) Methylation in Control 3.39E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

Body (cg27648056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:3.61E-06; Z-score:-3.11E+00

Methylation in Case

5.81E-01 (Median) Methylation in Control 7.49E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

Body (cg00981877)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:4.86E-06; Z-score:-1.32E+00

Methylation in Case

9.81E-02 (Median) Methylation in Control 1.40E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

Body (cg24131671)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:1.51E-05; Z-score:-1.88E+00

Methylation in Case

5.70E-01 (Median) Methylation in Control 6.79E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

Body (cg11981631)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.54E+00 Statistic Test p-value:2.69E-03; Z-score:1.96E+00

Methylation in Case

1.85E-01 (Median) Methylation in Control 1.20E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

Body (cg08225137)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.84E-03; Z-score:-1.10E+00

Methylation in Case

7.95E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC43A1 in colon adenocarcinoma [ 4 ]

Location

3'UTR (cg02497486)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.42E-03; Z-score:8.78E-01

Methylation in Case

8.77E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

5'UTR (cg08572535)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:2.56E-05; Z-score:-7.27E-01

Methylation in Case

7.82E-02 (Median) Methylation in Control 9.22E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg17363443)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:6.73E-03; Z-score:-6.60E-01

Methylation in Case

7.61E-02 (Median) Methylation in Control 8.40E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg17958577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:3.91E-13; Z-score:-3.77E+00

Methylation in Case

5.78E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg09478995)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:3.57E-09; Z-score:-1.72E+00

Methylation in Case

4.44E-01 (Median) Methylation in Control 5.96E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg04431596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.37E+00 Statistic Test p-value:2.27E-08; Z-score:-1.45E+00

Methylation in Case

3.73E-01 (Median) Methylation in Control 5.12E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:2.58E-06; Z-score:-1.12E+00

Methylation in Case

3.29E-01 (Median) Methylation in Control 4.10E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg10964211)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:4.08E-06; Z-score:6.40E-01

Methylation in Case

8.19E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg26418434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.39E+00 Statistic Test p-value:6.27E-06; Z-score:-1.02E+00

Methylation in Case

2.48E-01 (Median) Methylation in Control 3.44E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:7.55E-06; Z-score:-9.20E-01

Methylation in Case

2.93E-01 (Median) Methylation in Control 3.55E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg02680086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.61E+00 Statistic Test p-value:8.86E-06; Z-score:-1.21E+00

Methylation in Case

1.64E-01 (Median) Methylation in Control 2.63E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg23075364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:2.35E-05; Z-score:-1.03E+00

Methylation in Case

1.88E-01 (Median) Methylation in Control 2.77E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg25284762)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:6.64E-05; Z-score:-1.16E+00

Methylation in Case

3.56E-01 (Median) Methylation in Control 4.22E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:1.44E-03; Z-score:-9.57E-01

Methylation in Case

3.61E-01 (Median) Methylation in Control 4.31E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

Body (cg17559156)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:1.72E-02; Z-score:-1.17E+00

Methylation in Case

4.42E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC43A1 in hepatocellular carcinoma [ 5 ]

Location

3'UTR (cg19991086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:6.46E-12; Z-score:-2.77E+00

Methylation in Case

5.47E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

5'UTR (cg08572535)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:5.27E-05; Z-score:1.44E+00

Methylation in Case

1.25E-01 (Median) Methylation in Control 9.37E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

TSS1500 (cg05375277)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.57E+00 Statistic Test p-value:2.87E-03; Z-score:9.41E-01

Methylation in Case

1.16E-02 (Median) Methylation in Control 7.34E-03 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

TSS200 (cg02037518)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.90E+00 Statistic Test p-value:1.22E-02; Z-score:9.27E-01

Methylation in Case

9.08E-03 (Median) Methylation in Control 4.79E-03 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

TSS200 (cg17057783)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:3.54E-02; Z-score:7.25E-01

Methylation in Case

4.05E-02 (Median) Methylation in Control 3.39E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.43E+00 Statistic Test p-value:6.73E-14; Z-score:4.77E+00

Methylation in Case

7.09E-01 (Median) Methylation in Control 4.97E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

Body (cg25284762)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:2.71E-11; Z-score:1.56E+00

Methylation in Case

8.82E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

Body (cg11376147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:1.78E-07; Z-score:2.53E+00

Methylation in Case

2.39E-01 (Median) Methylation in Control 1.64E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

Body (cg23075364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:7.04E-07; Z-score:1.61E+00

Methylation in Case

6.35E-01 (Median) Methylation in Control 5.20E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:9.09E-06; Z-score:1.23E+00

Methylation in Case

5.96E-01 (Median) Methylation in Control 5.55E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

Body (cg26418434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:9.45E-06; Z-score:1.40E+00

Methylation in Case

5.57E-01 (Median) Methylation in Control 4.88E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

Body (cg02680086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:4.28E-05; Z-score:1.31E+00

Methylation in Case

5.83E-01 (Median) Methylation in Control 4.92E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.64E-03; Z-score:7.05E-01

Methylation in Case

5.08E-01 (Median) Methylation in Control 4.73E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC43A1 in HIV infection [ 6 ]

Location

3'UTR (cg09888840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.56E+00 Statistic Test p-value:4.30E-10; Z-score:3.11E+00

Methylation in Case

6.91E-01 (Median) Methylation in Control 4.42E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

5'UTR (cg11207893)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.20E-07; Z-score:-1.06E+00

Methylation in Case

9.00E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

5'UTR (cg16405055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.37E-02; Z-score:-6.62E-02

Methylation in Case

3.84E-02 (Median) Methylation in Control 3.91E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg01826863)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.74E+00 Statistic Test p-value:8.98E-22; Z-score:5.90E+00

Methylation in Case

3.73E-01 (Median) Methylation in Control 2.15E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg15828524)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:8.16E-05; Z-score:1.07E+00

Methylation in Case

8.65E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg19777783)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.22E-02; Z-score:-7.80E-01

Methylation in Case

6.11E-01 (Median) Methylation in Control 6.48E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS200 (cg09210286)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:1.93E-15; Z-score:3.07E+00

Methylation in Case

9.01E-02 (Median) Methylation in Control 6.48E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg13044838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.79E-09; Z-score:1.89E+00

Methylation in Case

8.46E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg20422819)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:6.55E-06; Z-score:1.50E+00

Methylation in Case

7.17E-01 (Median) Methylation in Control 6.54E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg20244340)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:5.98E-03; Z-score:-1.10E+00

Methylation in Case

2.53E-01 (Median) Methylation in Control 2.98E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg26572770)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:6.20E-03; Z-score:-3.38E-01

Methylation in Case

7.33E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg25213968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.42E-02; Z-score:-5.69E-01

Methylation in Case

7.02E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg20869999)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:3.53E-02; Z-score:2.28E-01

Methylation in Case

5.88E-01 (Median) Methylation in Control 5.83E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC43A1 in pancretic ductal adenocarcinoma [ 7 ]

Location

3'UTR (cg12468553)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.44E-02; Z-score:2.83E-01

Methylation in Case

8.20E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Colorectal cancer

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

TSS1500 (cg26624118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:3.29E-03; Z-score:7.02E-01

Methylation in Case

1.01E-01 (Median) Methylation in Control 9.30E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

TSS200 (cg23409370)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:4.00E-05; Z-score:-1.16E+00

Methylation in Case

1.05E-01 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

TSS200 (cg14028489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:4.87E-03; Z-score:7.29E-01

Methylation in Case

1.01E-02 (Median) Methylation in Control 8.31E-03 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

TSS200 (cg17057783)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.81E-02; Z-score:-3.18E-01

Methylation in Case

3.08E-02 (Median) Methylation in Control 3.43E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:6.68E-04; Z-score:1.20E+00

Methylation in Case

4.71E-01 (Median) Methylation in Control 3.68E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

Body (cg11376147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.49E-03; Z-score:-1.36E+00

Methylation in Case

2.91E-01 (Median) Methylation in Control 3.45E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

Body (cg26418434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:1.92E-03; Z-score:8.18E-01

Methylation in Case

2.29E-01 (Median) Methylation in Control 1.69E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:2.04E-03; Z-score:1.06E+00

Methylation in Case

3.33E-01 (Median) Methylation in Control 2.59E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

Body (cg02680086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:2.17E-03; Z-score:8.13E-01

Methylation in Case

1.88E-01 (Median) Methylation in Control 1.42E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:3.75E-03; Z-score:8.32E-01

Methylation in Case

3.98E-01 (Median) Methylation in Control 3.33E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

Body (cg23075364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:7.70E-03; Z-score:6.39E-01

Methylation in Case

4.25E-01 (Median) Methylation in Control 3.60E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC43A1 in colorectal cancer [ 8 ]

Location

Body (cg12619347)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.86E-02; Z-score:-9.69E-01

Methylation in Case

7.46E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg26624118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.60E-03; Z-score:-6.78E-01

Methylation in Case

6.80E-02 (Median) Methylation in Control 7.46E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

TSS200 (cg23409370)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:5.89E-03; Z-score:-6.41E-01

Methylation in Case

5.68E-02 (Median) Methylation in Control 6.48E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg10964211)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.52E-10; Z-score:-2.12E+00

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg09478995)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:1.34E-07; Z-score:1.49E+00

Methylation in Case

5.49E-01 (Median) Methylation in Control 4.28E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg25284762)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:5.37E-05; Z-score:5.91E-01

Methylation in Case

5.36E-01 (Median) Methylation in Control 5.03E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:8.49E-05; Z-score:1.13E+00

Methylation in Case

7.65E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg04431596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.59E-03; Z-score:-6.98E-01

Methylation in Case

9.47E-01 (Median) Methylation in Control 9.54E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:3.65E-02; Z-score:6.62E-01

Methylation in Case

2.65E-01 (Median) Methylation in Control 2.13E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg26418434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:3.78E-02; Z-score:6.10E-01

Methylation in Case

1.91E-01 (Median) Methylation in Control 1.42E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg11376147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:4.29E-02; Z-score:-5.41E-01

Methylation in Case

1.88E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

TSS1500 (cg20408693)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:5.63E+00 Statistic Test p-value:2.40E-03; Z-score:2.79E+01

Methylation in Case

5.36E-01 (Median) Methylation in Control 9.52E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

TSS200 (cg19766441)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.64E+00 Statistic Test p-value:3.25E-03; Z-score:1.38E+01

Methylation in Case

5.37E-01 (Median) Methylation in Control 8.09E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

TSS200 (cg23365801)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.72E+00 Statistic Test p-value:8.34E-03; Z-score:2.69E+00

Methylation in Case

6.38E-01 (Median) Methylation in Control 3.71E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

Body (cg10423743)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:4.92E-04; Z-score:4.48E+00

Methylation in Case

9.52E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

Body (cg09478995)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.57E+00 Statistic Test p-value:3.63E-03; Z-score:-4.03E+00

Methylation in Case

4.91E-01 (Median) Methylation in Control 7.70E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

Body (cg09565111)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:4.07E-03; Z-score:-4.09E+00

Methylation in Case

4.53E-01 (Median) Methylation in Control 6.03E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

Body (cg24738346)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.18E+00 Statistic Test p-value:4.55E-03; Z-score:3.09E+00

Methylation in Case

7.30E-01 (Median) Methylation in Control 3.35E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

Body (cg02902412)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:5.73E-03; Z-score:3.23E+00

Methylation in Case

9.40E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in prostate cancer [ 10 ]

Location

Body (cg16296843)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:1.97E-02; Z-score:-3.96E+00

Methylation in Case

4.37E-01 (Median) Methylation in Control 5.62E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in systemic lupus erythematosus [ 11 ]

Location

TSS1500 (cg05375277)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.22E-02; Z-score:1.30E-01

Methylation in Case

1.32E-02 (Median) Methylation in Control 1.26E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in systemic lupus erythematosus [ 11 ]

Location

TSS200 (cg18004239)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:4.98E-02; Z-score:1.44E-01

Methylation in Case

5.35E-02 (Median) Methylation in Control 5.18E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in systemic lupus erythematosus [ 11 ]

Location

Body (cg11376147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.99E-03; Z-score:-3.30E-01

Methylation in Case

2.73E-01 (Median) Methylation in Control 2.99E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in systemic lupus erythematosus [ 11 ]

Location

Body (cg10964211)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.58E-02; Z-score:2.10E-01

Methylation in Case

8.03E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in systemic lupus erythematosus [ 11 ]

Location

Body (cg25284762)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.29E-02; Z-score:-1.84E-01

Methylation in Case

9.03E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in systemic lupus erythematosus [ 11 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.87E-02; Z-score:-3.10E-01

Methylation in Case

5.66E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Bladder cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg11376147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.72E+00 Statistic Test p-value:2.74E-12; Z-score:-1.15E+01

Methylation in Case

1.66E-01 (Median) Methylation in Control 2.85E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:1.52E-06; Z-score:4.54E+00

Methylation in Case

6.37E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg04431596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.42E+00 Statistic Test p-value:3.52E-06; Z-score:-2.70E+01

Methylation in Case

6.39E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg12619347)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:3.62E-06; Z-score:-4.01E+00

Methylation in Case

3.56E-01 (Median) Methylation in Control 5.46E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg17559156)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.39E+00 Statistic Test p-value:9.22E-04; Z-score:-2.74E+00

Methylation in Case

5.14E-01 (Median) Methylation in Control 7.12E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg24733435)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.59E-03; Z-score:-1.65E+00

Methylation in Case

7.32E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:6.05E-03; Z-score:-2.12E+00

Methylation in Case

3.28E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg10964211)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:7.32E-03; Z-score:-2.32E+00

Methylation in Case

7.58E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg26418434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:8.42E-03; Z-score:-1.82E+00

Methylation in Case

2.43E-01 (Median) Methylation in Control 3.29E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.73E-02; Z-score:-6.56E-01

Methylation in Case

2.97E-01 (Median) Methylation in Control 3.17E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC43A1 in bladder cancer [ 12 ]

Location

Body (cg02680086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.64E+00 Statistic Test p-value:4.90E-02; Z-score:-1.85E+00

Methylation in Case

1.42E-01 (Median) Methylation in Control 2.33E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Celiac disease

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in celiac disease [ 13 ]

Location

Body (cg04431596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.50E+00 Statistic Test p-value:4.74E-02; Z-score:1.27E+00

Methylation in Case

5.83E-01 (Median) Methylation in Control 2.33E-01 (Median)

Studied Phenotype

Celiac disease[ ICD-11:DA95]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg23075364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.72E+00 Statistic Test p-value:2.62E-04; Z-score:3.86E+00

Methylation in Case

5.63E-01 (Median) Methylation in Control 3.28E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:2.82E-04; Z-score:2.81E+00

Methylation in Case

5.87E-01 (Median) Methylation in Control 4.64E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg26418434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:3.38E-04; Z-score:2.48E+00

Methylation in Case

5.44E-01 (Median) Methylation in Control 4.08E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC43A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg02680086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.63E+00 Statistic Test p-value:7.34E-04; Z-score:4.59E+00

Methylation in Case

5.10E-01 (Median) Methylation in Control 3.13E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC43A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg00089550)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.93E-02; Z-score:1.31E+00

Methylation in Case

5.00E-01 (Median) Methylation in Control 4.41E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC43A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg25284762)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:2.73E-02; Z-score:2.62E+00

Methylation in Case

6.30E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC43A1 in panic disorder [ 15 ]

Location

Body (cg17330838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+01 Statistic Test p-value:5.15E-03; Z-score:-4.82E-01

Methylation in Case

-6.35E-03 (Median) Methylation in Control 8.04E-02 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC43A1 in panic disorder [ 15 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.39E-01 Statistic Test p-value:1.55E-02; Z-score:-4.15E-01

Methylation in Case

-1.75E-01 (Median) Methylation in Control -2.43E-02 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC43A1 in panic disorder [ 15 ]

Location

3'UTR (cg09888840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-7.73E-01 Statistic Test p-value:1.83E-02; Z-score:-3.33E-01

Methylation in Case

-1.00E+00 (Median) Methylation in Control -7.74E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1226 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1226 miRNA Mature ID miR-1226-3p

miRNA Sequence

UCACCAGCCCUGUGUUCCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1238 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1238 miRNA Mature ID miR-1238-3p

miRNA Sequence

CUUCCUCGUCUGUCUGCCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1304 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-204 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-204 miRNA Mature ID miR-204-5p

miRNA Sequence

UUCCCUUUGUCAUCCUAUGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-211 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-211 miRNA Mature ID miR-211-5p

miRNA Sequence

UUCCCUUUGUCAUCCUUCGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-27b directly targets SLC43A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-27b miRNA Mature ID miR-27b-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-4676 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4676 miRNA Mature ID miR-4676-5p

miRNA Sequence

GAGCCAGUGGUGAGACAGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-4755 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4755 miRNA Mature ID miR-4755-5p

miRNA Sequence

UUUCCCUUCAGAGCCUGGCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-484 directly targets SLC43A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-484 miRNA Mature ID miR-484

miRNA Sequence

UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-5006 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5006 miRNA Mature ID miR-5006-3p

miRNA Sequence

UUUCCCUUUCCAUCCUGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-521 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-521 miRNA Mature ID miR-521

miRNA Sequence

AACGCACUUCCCUUUAGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-575 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-575 miRNA Mature ID miR-575

miRNA Sequence

GAGCCAGUUGGACAGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-623 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-623 miRNA Mature ID miR-623

miRNA Sequence

AUCCCUUGCAGGGGCUGUUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-670 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-670 miRNA Mature ID miR-670-3p

miRNA Sequence

UUUCCUCAUAUUCAUUCAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-6832 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6832 miRNA Mature ID miR-6832-3p

miRNA Sequence

ACCCUUUUUCUCUUUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-6881 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6881 miRNA Mature ID miR-6881-3p

miRNA Sequence

AUCCUCUUUCGUCCUUCCCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-7111 directly targets SLC43A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7111 miRNA Mature ID miR-7111-3p

miRNA Sequence

AUCCUCUCUUCCCUCCUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 DNA Methylation Dynamics in Urological Tumors.
13 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
14 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
17 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.