General Information of Drug Transporter (DT)
DT ID DTD0355 Transporter Info
Gene Name SLC41A2
Transporter Name Magnesium transporter protein solute carrier family 41 member 2
Gene ID
84102
UniProt ID
Q96JW4
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

5'UTR (cg09094674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:3.53E-02; Z-score:-1.47E+00

Methylation in Case

2.23E-01 (Median) Methylation in Control 2.68E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC41A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg03219657)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:2.18E-09; Z-score:-1.52E+00

Methylation in Case

3.19E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC41A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg07260532)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:1.33E-02; Z-score:-8.25E-01

Methylation in Case

1.83E-01 (Median) Methylation in Control 2.37E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC41A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

1stExon (cg04098339)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:8.86E-15; Z-score:2.44E+00

Methylation in Case

4.25E-01 (Median) Methylation in Control 3.29E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC41A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg16061354)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:5.42E-04; Z-score:-6.71E-01

Methylation in Case

8.21E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC41A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

3'UTR (cg22599115)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:6.11E-07; Z-score:1.66E+00

Methylation in Case

7.76E-01 (Median) Methylation in Control 6.28E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in bladder cancer [ 2 ]

Location

TSS1500 (cg23855818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:4.77E-06; Z-score:-5.15E+00

Methylation in Case

6.20E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC41A2 in bladder cancer [ 2 ]

Location

TSS1500 (cg20495009)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.26E-02; Z-score:-1.07E-01

Methylation in Case

7.41E-01 (Median) Methylation in Control 7.43E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC41A2 in bladder cancer [ 2 ]

Location

TSS200 (cg25107282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.22E-03; Z-score:-2.24E+00

Methylation in Case

7.09E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC41A2 in bladder cancer [ 2 ]

Location

Body (cg02329494)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.72E+00 Statistic Test p-value:3.46E-11; Z-score:-1.15E+01

Methylation in Case

2.92E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC41A2 in bladder cancer [ 2 ]

Location

Body (cg22784260)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.43E+00 Statistic Test p-value:9.42E-10; Z-score:-9.46E+00

Methylation in Case

2.57E-01 (Median) Methylation in Control 6.25E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC41A2 in bladder cancer [ 2 ]

Location

Body (cg02071798)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.71E-03; Z-score:-2.66E+00

Methylation in Case

6.44E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in breast cancer [ 3 ]

Location

TSS1500 (cg20495009)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:8.95E-05; Z-score:-9.47E-01

Methylation in Case

6.90E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC41A2 in breast cancer [ 3 ]

Location

TSS1500 (cg23855818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.18E-02; Z-score:-2.13E-01

Methylation in Case

7.72E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC41A2 in breast cancer [ 3 ]

Location

TSS200 (cg25107282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:6.77E-07; Z-score:1.35E+00

Methylation in Case

7.25E-01 (Median) Methylation in Control 6.26E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC41A2 in breast cancer [ 3 ]

Location

Body (cg02329494)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.83E-09; Z-score:-2.11E+00

Methylation in Case

8.31E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC41A2 in breast cancer [ 3 ]

Location

Body (cg02071798)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.05E-05; Z-score:-1.22E+00

Methylation in Case

6.36E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC41A2 in breast cancer [ 3 ]

Location

Body (cg22784260)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.57E-03; Z-score:-1.00E-01

Methylation in Case

7.81E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg23855818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:7.34E-06; Z-score:-1.09E+00

Methylation in Case

4.86E-01 (Median) Methylation in Control 5.95E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC41A2 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg20495009)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.10E-02; Z-score:-2.56E-01

Methylation in Case

7.89E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC41A2 in hepatocellular carcinoma [ 4 ]

Location

Body (cg17836790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:5.08E-11; Z-score:-5.91E+00

Methylation in Case

6.12E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC41A2 in hepatocellular carcinoma [ 4 ]

Location

Body (cg02329494)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.12E-04; Z-score:-4.65E-01

Methylation in Case

8.36E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in lung adenocarcinoma [ 5 ]

Location

TSS1500 (cg23855818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.40E-02; Z-score:9.24E-01

Methylation in Case

8.18E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC41A2 in lung adenocarcinoma [ 5 ]

Location

Body (cg02071798)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:3.41E-04; Z-score:-3.41E+00

Methylation in Case

7.20E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in panic disorder [ 6 ]

Location

TSS200 (cg25107282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-7.96E-01 Statistic Test p-value:1.35E-02; Z-score:-4.61E-01

Methylation in Case

-6.00E-01 (Median) Methylation in Control -4.78E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC41A2 in panic disorder [ 6 ]

Location

Body (cg02329494)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.12E-03; Z-score:-3.58E-01

Methylation in Case

7.97E-01 (Median) Methylation in Control 9.79E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in papillary thyroid cancer [ 7 ]

Location

TSS200 (cg25107282)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.65E-02; Z-score:-5.35E-01

Methylation in Case

8.78E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC41A2 in papillary thyroid cancer [ 7 ]

Location

Body (cg22784260)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:6.81E-12; Z-score:-2.22E+00

Methylation in Case

5.45E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC41A2 in papillary thyroid cancer [ 7 ]

Location

Body (cg02329494)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:6.75E-03; Z-score:5.16E-01

Methylation in Case

9.44E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Colorectal cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in colorectal cancer [ 8 ]

Location

Body (cg02071798)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:4.24E-14; Z-score:-2.83E+00

Methylation in Case

6.84E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC41A2 in colorectal cancer [ 8 ]

Location

Body (cg22784260)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.38E-02; Z-score:-3.78E-01

Methylation in Case

8.63E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC41A2 in prostate cancer [ 9 ]

Location

Body (cg03731131)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:3.63E-02; Z-score:2.01E+00

Methylation in Case

7.13E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC41A2 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.46E-15; Fold-change:-0.25749522; Z-score:-5.787330013
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Multilayered rosettes embryonal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC41A2 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.49E-17; Fold-change:-0.243857801; Z-score:-5.47748559
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         33 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-126 directly targets SLC41A2 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-126 miRNA Mature ID miR-126-3p

miRNA Sequence

UCGUACCGUGAGUAAUAAUGCG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon2

miR-1827 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1827 miRNA Mature ID miR-1827

miRNA Sequence

UGAGGCAGUAGAUUGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-22 directly targets SLC41A2 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-22 miRNA Mature ID miR-22-5p

miRNA Sequence

AGUUCUUCAGUGGCAAGCUUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-3184 directly targets SLC41A2 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3184 miRNA Mature ID miR-3184-3p

miRNA Sequence

AAAGUCUCGCUCUCUGCCCCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-342 directly targets SLC41A2 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-342 miRNA Mature ID miR-342-3p

miRNA Sequence

UCUCACACAGAAAUCGCACCCGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-34b directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-34b miRNA Mature ID miR-34b-3p

miRNA Sequence

CAAUCACUAACUCCACUGCCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-3614 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3614 miRNA Mature ID miR-3614-5p

miRNA Sequence

CCACUUGGAUCUGAAGGCUGCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-3689d directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-377 directly targets SLC41A2 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-377 miRNA Mature ID miR-377-3p

miRNA Sequence

AUCACACAAAGGCAACUUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-3929 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-4478 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

GAGGCUGAGCUGAGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-4649 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4649 miRNA Mature ID miR-4649-3p

miRNA Sequence

UCUGAGGCCUGCCUCUCCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-4722 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-4768 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-485 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-6134 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

UGAGGUGGUAGGAUGUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-6500 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6500 miRNA Mature ID miR-6500-3p

miRNA Sequence

ACACUUGUUGGGAUGACCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-665 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-6746 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6746 miRNA Mature ID miR-6746-5p

miRNA Sequence

CCGGGAGAAGGAGGUGGCCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-6771 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6771 miRNA Mature ID miR-6771-5p

miRNA Sequence

CUCGGGAGGGCAUGGGCCAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-6808 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6808 miRNA Mature ID miR-6808-5p

miRNA Sequence

CAGGCAGGGAGGUGGGACCAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-6817 directly targets SLC41A2 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6817 miRNA Mature ID miR-6817-3p

miRNA Sequence

UCUCUCUGACUCCAUGGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-6851 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-6873 directly targets SLC41A2 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6873 miRNA Mature ID miR-6873-3p

miRNA Sequence

UUCUCUCUGUCUUUCUCUCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-6880 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6880 miRNA Mature ID miR-6880-5p

miRNA Sequence

UGGUGGAGGAAGAGGGCAGCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-6884 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-6893 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6893 miRNA Mature ID miR-6893-5p

miRNA Sequence

CAGGCAGGUGUAGGGUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-6895 directly targets SLC41A2 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6895 miRNA Mature ID miR-6895-3p

miRNA Sequence

UGUCUCUCGCCCUUGGCCUUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-7110 directly targets SLC41A2 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7110 miRNA Mature ID miR-7110-3p

miRNA Sequence

UCUCUCUCCCACUUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-7160 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7160 miRNA Mature ID miR-7160-5p

miRNA Sequence

UGCUGAGGUCCGGGCUGUGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-7847 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7847 miRNA Mature ID miR-7847-3p

miRNA Sequence

CGUGGAGGACGAGGAGGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-8485 directly targets SLC41A2 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

CACACACACACACACACGUAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon33

miR-940 directly targets SLC41A2 [ 11 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-940 miRNA Mature ID miR-940

miRNA Sequence

AAGGCAGGGCCCCCGCUCCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
11 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
12 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
13 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.