Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0355 Transporter Info
Gene Name	SLC41A2
Transporter Name	Magnesium transporter protein solute carrier family 41 member 2
Gene ID	84102
UniProt ID	Q96JW4

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg09094674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:3.53E-02; Z-score:-1.47E+00
Methylation in Case	2.23E-01 (Median)	Methylation in Control	2.68E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC41A2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg03219657)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:2.18E-09; Z-score:-1.52E+00
Methylation in Case	3.19E-01 (Median)	Methylation in Control	4.79E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC41A2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg07260532)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:1.33E-02; Z-score:-8.25E-01
Methylation in Case	1.83E-01 (Median)	Methylation in Control	2.37E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC41A2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	1stExon (cg04098339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:8.86E-15; Z-score:2.44E+00
Methylation in Case	4.25E-01 (Median)	Methylation in Control	3.29E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC41A2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg16061354)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:5.42E-04; Z-score:-6.71E-01
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC41A2 in pancretic ductal adenocarcinoma			[ 1 ]
Location	3'UTR (cg22599115)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:6.11E-07; Z-score:1.66E+00
Methylation in Case	7.76E-01 (Median)	Methylation in Control	6.28E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg23855818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:4.77E-06; Z-score:-5.15E+00
Methylation in Case	6.20E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC41A2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg20495009)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:4.26E-02; Z-score:-1.07E-01
Methylation in Case	7.41E-01 (Median)	Methylation in Control	7.43E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC41A2 in bladder cancer			[ 2 ]
Location	TSS200 (cg25107282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.22E-03; Z-score:-2.24E+00
Methylation in Case	7.09E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC41A2 in bladder cancer			[ 2 ]
Location	Body (cg02329494)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.72E+00	Statistic Test	p-value:3.46E-11; Z-score:-1.15E+01
Methylation in Case	2.92E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC41A2 in bladder cancer			[ 2 ]
Location	Body (cg22784260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.43E+00	Statistic Test	p-value:9.42E-10; Z-score:-9.46E+00
Methylation in Case	2.57E-01 (Median)	Methylation in Control	6.25E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC41A2 in bladder cancer			[ 2 ]
Location	Body (cg02071798)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:1.71E-03; Z-score:-2.66E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	6.93E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in breast cancer			[ 3 ]
Location	TSS1500 (cg20495009)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:8.95E-05; Z-score:-9.47E-01
Methylation in Case	6.90E-01 (Median)	Methylation in Control	7.35E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC41A2 in breast cancer			[ 3 ]
Location	TSS1500 (cg23855818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.18E-02; Z-score:-2.13E-01
Methylation in Case	7.72E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC41A2 in breast cancer			[ 3 ]
Location	TSS200 (cg25107282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:6.77E-07; Z-score:1.35E+00
Methylation in Case	7.25E-01 (Median)	Methylation in Control	6.26E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC41A2 in breast cancer			[ 3 ]
Location	Body (cg02329494)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:3.83E-09; Z-score:-2.11E+00
Methylation in Case	8.31E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC41A2 in breast cancer			[ 3 ]
Location	Body (cg02071798)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.05E-05; Z-score:-1.22E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	7.20E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC41A2 in breast cancer			[ 3 ]
Location	Body (cg22784260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.57E-03; Z-score:-1.00E-01
Methylation in Case	7.81E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg23855818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:7.34E-06; Z-score:-1.09E+00
Methylation in Case	4.86E-01 (Median)	Methylation in Control	5.95E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC41A2 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg20495009)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.10E-02; Z-score:-2.56E-01
Methylation in Case	7.89E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC41A2 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg17836790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:5.08E-11; Z-score:-5.91E+00
Methylation in Case	6.12E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC41A2 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg02329494)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.12E-04; Z-score:-4.65E-01
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in lung adenocarcinoma			[ 5 ]
Location	TSS1500 (cg23855818)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:3.40E-02; Z-score:9.24E-01
Methylation in Case	8.18E-01 (Median)	Methylation in Control	7.73E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC41A2 in lung adenocarcinoma			[ 5 ]
Location	Body (cg02071798)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.41E-04; Z-score:-3.41E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in panic disorder			[ 6 ]
Location	TSS200 (cg25107282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-7.96E-01	Statistic Test	p-value:1.35E-02; Z-score:-4.61E-01
Methylation in Case	-6.00E-01 (Median)	Methylation in Control	-4.78E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC41A2 in panic disorder			[ 6 ]
Location	Body (cg02329494)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:1.12E-03; Z-score:-3.58E-01
Methylation in Case	7.97E-01 (Median)	Methylation in Control	9.79E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in papillary thyroid cancer			[ 7 ]
Location	TSS200 (cg25107282)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.65E-02; Z-score:-5.35E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC41A2 in papillary thyroid cancer			[ 7 ]
Location	Body (cg22784260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:6.81E-12; Z-score:-2.22E+00
Methylation in Case	5.45E-01 (Median)	Methylation in Control	7.44E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC41A2 in papillary thyroid cancer			[ 7 ]
Location	Body (cg02329494)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:6.75E-03; Z-score:5.16E-01
Methylation in Case	9.44E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Colorectal cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in colorectal cancer			[ 8 ]
Location	Body (cg02071798)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:4.24E-14; Z-score:-2.83E+00
Methylation in Case	6.84E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC41A2 in colorectal cancer			[ 8 ]
Location	Body (cg22784260)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.38E-02; Z-score:-3.78E-01
Methylation in Case	8.63E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC41A2 in prostate cancer			[ 9 ]
Location	Body (cg03731131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:3.63E-02; Z-score:2.01E+00
Methylation in Case	7.13E-01 (Median)	Methylation in Control	5.89E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC41A2 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:4.46E-15; Fold-change:-0.25749522; Z-score:-5.787330013
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC41A2 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.49E-17; Fold-change:-0.243857801; Z-score:-5.47748559
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	33 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-126 directly targets SLC41A2			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-126	miRNA Mature ID	miR-126-3p
miRNA Sequence	UCGUACCGUGAGUAAUAAUGCG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon2	miR-1827 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1827	miRNA Mature ID	miR-1827
miRNA Sequence	UGAGGCAGUAGAUUGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-22 directly targets SLC41A2			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-22	miRNA Mature ID	miR-22-5p
miRNA Sequence	AGUUCUUCAGUGGCAAGCUUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-3184 directly targets SLC41A2			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3184	miRNA Mature ID	miR-3184-3p
miRNA Sequence	AAAGUCUCGCUCUCUGCCCCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-342 directly targets SLC41A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-342	miRNA Mature ID	miR-342-3p
miRNA Sequence	UCUCACACAGAAAUCGCACCCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-34b directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-34b	miRNA Mature ID	miR-34b-3p
miRNA Sequence	CAAUCACUAACUCCACUGCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-3614 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3614	miRNA Mature ID	miR-3614-5p
miRNA Sequence	CCACUUGGAUCUGAAGGCUGCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-3689d directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3689d	miRNA Mature ID	miR-3689d
miRNA Sequence	GGGAGGUGUGAUCUCACACUCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-377 directly targets SLC41A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-377	miRNA Mature ID	miR-377-3p
miRNA Sequence	AUCACACAAAGGCAACUUUUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-3929 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3929	miRNA Mature ID	miR-3929
miRNA Sequence	GAGGCUGAUGUGAGUAGACCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-4478 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4478	miRNA Mature ID	miR-4478
miRNA Sequence	GAGGCUGAGCUGAGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-4649 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4649	miRNA Mature ID	miR-4649-3p
miRNA Sequence	UCUGAGGCCUGCCUCUCCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-4722 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-5p
miRNA Sequence	GGCAGGAGGGCUGUGCCAGGUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-4768 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4768	miRNA Mature ID	miR-4768-3p
miRNA Sequence	CCAGGAGAUCCAGAGAGAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-485 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-485	miRNA Mature ID	miR-485-5p
miRNA Sequence	AGAGGCUGGCCGUGAUGAAUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-6134 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6134	miRNA Mature ID	miR-6134
miRNA Sequence	UGAGGUGGUAGGAUGUAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-6500 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6500	miRNA Mature ID	miR-6500-3p
miRNA Sequence	ACACUUGUUGGGAUGACCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-665 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-6746 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6746	miRNA Mature ID	miR-6746-5p
miRNA Sequence	CCGGGAGAAGGAGGUGGCCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-6771 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6771	miRNA Mature ID	miR-6771-5p
miRNA Sequence	CUCGGGAGGGCAUGGGCCAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-6808 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6808	miRNA Mature ID	miR-6808-5p
miRNA Sequence	CAGGCAGGGAGGUGGGACCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-6817 directly targets SLC41A2			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6817	miRNA Mature ID	miR-6817-3p
miRNA Sequence	UCUCUCUGACUCCAUGGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-6851 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6851	miRNA Mature ID	miR-6851-5p
miRNA Sequence	AGGAGGUGGUACUAGGGGCCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-6873 directly targets SLC41A2			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6873	miRNA Mature ID	miR-6873-3p
miRNA Sequence	UUCUCUCUGUCUUUCUCUCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-6880 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6880	miRNA Mature ID	miR-6880-5p
miRNA Sequence	UGGUGGAGGAAGAGGGCAGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-6884 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6884	miRNA Mature ID	miR-6884-5p
miRNA Sequence	AGAGGCUGAGAAGGUGAUGUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-6893 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6893	miRNA Mature ID	miR-6893-5p
miRNA Sequence	CAGGCAGGUGUAGGGUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-6895 directly targets SLC41A2			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6895	miRNA Mature ID	miR-6895-3p
miRNA Sequence	UGUCUCUCGCCCUUGGCCUUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-7110 directly targets SLC41A2			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7110	miRNA Mature ID	miR-7110-3p
miRNA Sequence	UCUCUCUCCCACUUCCCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-7160 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7160	miRNA Mature ID	miR-7160-5p
miRNA Sequence	UGCUGAGGUCCGGGCUGUGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-7847 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7847	miRNA Mature ID	miR-7847-3p
miRNA Sequence	CGUGGAGGACGAGGAGGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-8485 directly targets SLC41A2			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8485	miRNA Mature ID	miR-8485
miRNA Sequence	CACACACACACACACACGUAU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon33	miR-940 directly targets SLC41A2			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-940	miRNA Mature ID	miR-940
miRNA Sequence	AAGGCAGGGCCCCCGCUCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
11	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
12	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
13	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence