General Information of Drug Transporter (DT)
DT ID DTD0352 Transporter Info
Gene Name SLC3A2
Transporter Name Lymphocyte activation antigen 4F2
Gene ID
6520
UniProt ID
P08195
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-10a directly targets SLC3A2 [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-1260b directly targets SLC3A2 [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

AUCCCACCACUGCCACCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-16 directly targets SLC3A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon4

miR-193b directly targets SLC3A2 [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-2115 directly targets SLC3A2 [ 3 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-2115 miRNA Mature ID miR-2115-3p

miRNA Sequence

CAUCAGAAUUCAUGGAGGCUAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-26b directly targets SLC3A2 [ 4 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon7

miR-412 directly targets SLC3A2 [ 5 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-412 miRNA Mature ID miR-412-3p

miRNA Sequence

ACUUCACCUGGUCCACUAGCCGU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

miR-4311 directly targets SLC3A2 [ 3 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4311 miRNA Mature ID miR-4311

miRNA Sequence

GAAAGAGAGCUGAGUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-4709 directly targets SLC3A2 [ 3 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4709 miRNA Mature ID miR-4709-5p

miRNA Sequence

ACAACAGUGACUUGCUCUCCAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-548c directly targets SLC3A2 [ 3 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548c miRNA Mature ID miR-548c-3p

miRNA Sequence

CAAAAAUCUCAAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-6844 directly targets SLC3A2 [ 3 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6844 miRNA Mature ID miR-6844

miRNA Sequence

UUCUUUGUUUUUAAUUCACAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-8068 directly targets SLC3A2 [ 3 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8068 miRNA Mature ID miR-8068

miRNA Sequence

UGUUUGUUGUAAGGAUCGUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-92a directly targets SLC3A2 [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

Methylation

  Glioblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC3A2 in glioblastoma than that in healthy individual

Studied Phenotype

Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.93E-09; Fold-change:-0.203328982; Z-score:-1.330229584
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Hemangioblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC3A2 in hemangioblastoma than that in healthy individual

Studied Phenotype

Hemangioblastoma [ICD-11:2F7C]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.66E-09; Fold-change:-0.288578473; Z-score:-2.046064481
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Uterine carcinosarcoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC3A2 in uterine carcinosarcoma than that in healthy individual

Studied Phenotype

Uterine carcinosarcoma [ICD-11:2B5F]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.89E-05; Fold-change:0.333757603; Z-score:1.947678188
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC3A2 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.49E-42; Fold-change:-0.473515129; Z-score:-7.442986446
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
2 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
3 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
4 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
5 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.