General Information of Drug Transporter (DT)
DT ID DTD0350 Transporter Info
Gene Name SLC39A9
Transporter Name Zinc transporter ZIP9
Gene ID
55334
UniProt ID
Q9NUM3
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg08828036)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.42E+00 Statistic Test p-value:2.42E-07; Z-score:1.83E+00

Methylation in Case

6.79E-01 (Median) Methylation in Control 4.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg06955716)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.15E-03; Z-score:8.43E-01

Methylation in Case

9.26E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A9 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg13990980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:4.08E-02; Z-score:2.35E-01

Methylation in Case

9.22E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC39A9 in atypical teratoid rhabdoid tumor [ 2 ]

Location

3'UTR (cg10776397)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.68E+00 Statistic Test p-value:3.35E-12; Z-score:2.17E+00

Methylation in Case

8.65E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in bladder cancer [ 3 ]

Location

Body (cg06955716)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:3.82E-08; Z-score:-1.45E+01

Methylation in Case

6.12E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in breast cancer [ 4 ]

Location

Body (cg13990980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:5.95E-05; Z-score:-1.11E+00

Methylation in Case

8.40E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in colorectal cancer [ 5 ]

Location

Body (cg06955716)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.61E-05; Z-score:-8.03E-01

Methylation in Case

8.94E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A9 in colorectal cancer [ 5 ]

Location

Body (cg13990980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.63E-02; Z-score:-4.93E-01

Methylation in Case

9.25E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in depression [ 6 ]

Location

Body (cg13990980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.87E-02; Z-score:-4.66E-01

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in hepatocellular carcinoma [ 7 ]

Location

Body (cg06955716)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:4.29E-08; Z-score:-1.91E+00

Methylation in Case

8.15E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A9 in hepatocellular carcinoma [ 7 ]

Location

Body (cg13990980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.35E-04; Z-score:-6.70E-01

Methylation in Case

8.48E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in HIV infection [ 8 ]

Location

Body (cg06955716)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.62E-06; Z-score:-1.70E+00

Methylation in Case

8.92E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A9 in HIV infection [ 8 ]

Location

Body (cg13990980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.53E-02; Z-score:-6.07E-01

Methylation in Case

9.19E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC39A9 in HIV infection [ 8 ]

Location

3'UTR (cg10776397)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.89E-02; Z-score:-4.44E-01

Methylation in Case

9.47E-01 (Median) Methylation in Control 9.58E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A9 in papillary thyroid cancer [ 9 ]

Location

Body (cg13990980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.77E-04; Z-score:-5.92E-01

Methylation in Case

9.15E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         66 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1226 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1226 miRNA Mature ID miR-1226-3p

miRNA Sequence

UCACCAGCCCUGUGUUCCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1323 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1323 miRNA Mature ID miR-1323

miRNA Sequence

UCAAAACUGAGGGGCAUUUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-133a directly targets SLC39A9 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-133a miRNA Mature ID miR-133a-5p

miRNA Sequence

AGCUGGUAAAAUGGAACCAAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-142 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-142 miRNA Mature ID miR-142-3p

miRNA Sequence

UGUAGUGUUUCCUACUUUAUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-151a directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-151a miRNA Mature ID miR-151a-5p

miRNA Sequence

UCGAGGAGCUCACAGUCUAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-151b directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-151b miRNA Mature ID miR-151b

miRNA Sequence

UCGAGGAGCUCACAGUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-15a directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-15b directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-16 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-192 directly targets SLC39A9 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-3p

miRNA Sequence

CUGCCAAUUCCAUAGGUCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-192 directly targets SLC39A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

CUGACCUAUGAAUUGACAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-195 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-19a directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19a miRNA Mature ID miR-19a-5p

miRNA Sequence

AGUUUUGCAUAGUUGCACUACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-19b-1 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19b-1 miRNA Mature ID miR-19b-1-5p

miRNA Sequence

AGUUUUGCAGGUUUGCAUCCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-19b-2 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19b-2 miRNA Mature ID miR-19b-2-5p

miRNA Sequence

AGUUUUGCAGGUUUGCAUUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-203a directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-203a miRNA Mature ID miR-203a-3p

miRNA Sequence

GUGAAAUGUUUAGGACCACUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-204 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-204 miRNA Mature ID miR-204-5p

miRNA Sequence

UUCCCUUUGUCAUCCUAUGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-2052 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-2052 miRNA Mature ID miR-2052

miRNA Sequence

UGUUUUGAUAACAGUAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-211 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-211 miRNA Mature ID miR-211-5p

miRNA Sequence

UUCCCUUUGUCAUCCUUCGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-215 directly targets SLC39A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

AUGACCUAUGAAUUGACAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-218 directly targets SLC39A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-218-1 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-218-1 miRNA Mature ID miR-218-1-3p

miRNA Sequence

AUGGUUCCGUCAAGCACCAUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-224 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-224 miRNA Mature ID miR-224-3p

miRNA Sequence

AAAAUGGUGCCCUAGUGACUACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-3117 directly targets SLC39A9 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3117 miRNA Mature ID miR-3117-5p

miRNA Sequence

AGACACUAUACGAGUCAUAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-3150b directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3150b miRNA Mature ID miR-3150b-3p

miRNA Sequence

UGAGGAGAUCGUCGAGGUUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-33a directly targets SLC39A9 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-33a miRNA Mature ID miR-33a-3p

miRNA Sequence

CAAUGUUUCCACAGUGCAUCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-3613 directly targets SLC39A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3613 miRNA Mature ID miR-3613-3p

miRNA Sequence

ACAAAAAAAAAAGCCCAACCCUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-3679 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3679 miRNA Mature ID miR-3679-3p

miRNA Sequence

CUUCCCCCCAGUAAUCUUCAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-371b directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-373 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-3929 directly targets SLC39A9 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-3975 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3975 miRNA Mature ID miR-3975

miRNA Sequence

UGAGGCUAAUGCACUACUUCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-424 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-424 miRNA Mature ID miR-424-5p

miRNA Sequence

CAGCAGCAAUUCAUGUUUUGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-4280 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4280 miRNA Mature ID miR-4280

miRNA Sequence

GAGUGUAGUUCUGAGCAGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-4307 directly targets SLC39A9 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4307 miRNA Mature ID miR-4307

miRNA Sequence

AAUGUUUUUUCCUGUUUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-432 directly targets SLC39A9 [ 18 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-432 miRNA Mature ID miR-432-3p

miRNA Sequence

CUGGAUGGCUCCUCCAUGUCU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon37

miR-4474 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4474 miRNA Mature ID miR-4474-3p

miRNA Sequence

UUGUGGCUGGUCAUGAGGCUAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-4478 directly targets SLC39A9 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

GAGGCUGAGCUGAGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-4490 directly targets SLC39A9 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4490 miRNA Mature ID miR-4490

miRNA Sequence

UCUGGUAAGAGAUUUGGGCAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-4530 directly targets SLC39A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4530 miRNA Mature ID miR-4530

miRNA Sequence

CCCAGCAGGACGGGAGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-4684 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4684 miRNA Mature ID miR-4684-5p

miRNA Sequence

CUCUCUACUGACUUGCAACAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-4691 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4691 miRNA Mature ID miR-4691-3p

miRNA Sequence

CCAGCCACGGACUGAGAGUGCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-4768 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4768 miRNA Mature ID miR-4768-5p

miRNA Sequence

AUUCUCUCUGGAUCCCAUGGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-4784 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

UGAGGAGAUGCUGGGACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-485 directly targets SLC39A9 [ 18 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon46

miR-497 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-497 miRNA Mature ID miR-497-5p

miRNA Sequence

CAGCAGCACACUGUGGUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon47

miR-510 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-510 miRNA Mature ID miR-510-3p

miRNA Sequence

AUUGAAACCUCUAAGAGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-5190 directly targets SLC39A9 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5190 miRNA Mature ID miR-5190

miRNA Sequence

CCAGUGACUGAGCUGGAGCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon49

miR-520f directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520f miRNA Mature ID miR-520f-5p

miRNA Sequence

CCUCUAAAGGGAAGCGCUUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-522 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-522 miRNA Mature ID miR-522-3p

miRNA Sequence

AAAAUGGUUCCCUUUAGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-545 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-545 miRNA Mature ID miR-545-3p

miRNA Sequence

UCAGCAAACAUUUAUUGUGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-548o directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548o miRNA Mature ID miR-548o-3p

miRNA Sequence

CCAAAACUGCAGUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon53

miR-5584 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5584 miRNA Mature ID miR-5584-5p

miRNA Sequence

CAGGGAAAUGGGAAGAACUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon54

miR-616 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon55

miR-634 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-634 miRNA Mature ID miR-634

miRNA Sequence

AACCAGCACCCCAACUUUGGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-659 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-659 miRNA Mature ID miR-659-3p

miRNA Sequence

CUUGGUUCAGGGAGGGUCCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-6792 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6792 miRNA Mature ID miR-6792-5p

miRNA Sequence

GUAAGCAGGGGCUCUGGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon58

miR-6832 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6832 miRNA Mature ID miR-6832-3p

miRNA Sequence

ACCCUUUUUCUCUUUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-6833 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6833 miRNA Mature ID miR-6833-3p

miRNA Sequence

UUUCUCUCUCCACUUCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon60

miR-6838 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6838 miRNA Mature ID miR-6838-5p

miRNA Sequence

AAGCAGCAGUGGCAAGACUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-6873 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6873 miRNA Mature ID miR-6873-5p

miRNA Sequence

CAGAGGGAAUACAGAGGGCAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon62

miR-7108 directly targets SLC39A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7108 miRNA Mature ID miR-7108-5p

miRNA Sequence

GUGUGGCCGGCAGGCGGGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon63

miR-8066 directly targets SLC39A9 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8066 miRNA Mature ID miR-8066

miRNA Sequence

CAAUGUGAUCUUUUGGAUGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon64

miR-8080 directly targets SLC39A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8080 miRNA Mature ID miR-8080

miRNA Sequence

GAAGGACACUGGUGUCAACGGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon65

miR-888 directly targets SLC39A9 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-888 miRNA Mature ID miR-888-5p

miRNA Sequence

UACUCAAAAAGCUGUCAGUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon66

miR-891b directly targets SLC39A9 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-891b miRNA Mature ID miR-891b

miRNA Sequence

UGCAACUUACCUGAGUCAUUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
11 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
12 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
13 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
14 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
15 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
16 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
17 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
18 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.