Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0348 Transporter Info | ||||
Gene Name | SLC39A7 | ||||
Transporter Name | Zinc transporter SLC39A7 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-1229 directly targets SLC39A7 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-1229 | miRNA Mature ID | miR-1229-3p | ||
miRNA Sequence |
CUCUCACCACUGCCCUCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon2 |
miR-128 directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-128 | miRNA Mature ID | miR-128-3p | ||
miRNA Sequence |
UCACAGUGAACCGGUCUCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon3 |
miR-216a directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-216a | miRNA Mature ID | miR-216a-3p | ||
miRNA Sequence |
UCACAGUGGUCUCUGGGAUUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon4 |
miR-3163 directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3163 | miRNA Mature ID | miR-3163 | ||
miRNA Sequence |
UAUAAAAUGAGGGCAGUAAGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon5 |
miR-340 directly targets SLC39A7 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
miRNA Stemloop ID |
miR-340 | miRNA Mature ID | miR-340-5p | ||
miRNA Sequence |
UUAUAAAGCAAUGAGACUGAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon6 |
miR-3681 directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3681 | miRNA Mature ID | miR-3681-3p | ||
miRNA Sequence |
ACACAGUGCUUCAUCCACUACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon7 |
miR-3689a directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3689a | miRNA Mature ID | miR-3689a-5p | ||
miRNA Sequence |
UGUGAUAUCAUGGUUCCUGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon8 |
miR-3689b directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3689b | miRNA Mature ID | miR-3689b-5p | ||
miRNA Sequence |
UGUGAUAUCAUGGUUCCUGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon9 |
miR-3689e directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3689e | miRNA Mature ID | miR-3689e | ||
miRNA Sequence |
UGUGAUAUCAUGGUUCCUGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon10 |
miR-3689f directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3689f | miRNA Mature ID | miR-3689f | ||
miRNA Sequence |
UGUGAUAUCGUGCUUCCUGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon11 |
miR-6715b directly targets SLC39A7 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6715b | miRNA Mature ID | miR-6715b-3p | ||
miRNA Sequence |
CUCAAACCGGCUGUGCCUGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC39A7 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.39E-37; Fold-change:-0.434958785; Z-score:-5.705243258 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.