General Information of Drug Transporter (DT)
DT ID DTD0348 Transporter Info
Gene Name SLC39A7
Transporter Name Zinc transporter SLC39A7
Gene ID
7922
UniProt ID
Q92504
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1229 directly targets SLC39A7 [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-1229 miRNA Mature ID miR-1229-3p

miRNA Sequence

CUCUCACCACUGCCCUCCCACAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-128 directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-128 miRNA Mature ID miR-128-3p

miRNA Sequence

UCACAGUGAACCGGUCUCUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-216a directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-216a miRNA Mature ID miR-216a-3p

miRNA Sequence

UCACAGUGGUCUCUGGGAUUAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-3163 directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3163 miRNA Mature ID miR-3163

miRNA Sequence

UAUAAAAUGAGGGCAGUAAGAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-340 directly targets SLC39A7 [ 3 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-3681 directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3681 miRNA Mature ID miR-3681-3p

miRNA Sequence

ACACAGUGCUUCAUCCACUACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-3689a directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689a miRNA Mature ID miR-3689a-5p

miRNA Sequence

UGUGAUAUCAUGGUUCCUGGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-3689b directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689b miRNA Mature ID miR-3689b-5p

miRNA Sequence

UGUGAUAUCAUGGUUCCUGGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-3689e directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689e miRNA Mature ID miR-3689e

miRNA Sequence

UGUGAUAUCAUGGUUCCUGGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-3689f directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689f miRNA Mature ID miR-3689f

miRNA Sequence

UGUGAUAUCGUGCUUCCUGGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-6715b directly targets SLC39A7 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6715b miRNA Mature ID miR-6715b-3p

miRNA Sequence

CUCAAACCGGCUGUGCCUGUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

Methylation

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC39A7 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.39E-37; Fold-change:-0.434958785; Z-score:-5.705243258
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
2 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
3 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.