General Information of Drug Transporter (DT)
DT ID DTD0347 Transporter Info
Gene Name SLC39A6
Transporter Name Zinc transporter ZIP6
Gene ID
25800
UniProt ID
Q13433
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A6 in pancretic ductal adenocarcinoma [ 1 ]

Location

5'UTR (cg26382075)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.81E+00 Statistic Test p-value:6.19E-13; Z-score:1.86E+00

Methylation in Case

4.69E-02 (Median) Methylation in Control 2.59E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A6 in atypical teratoid rhabdoid tumor [ 2 ]

Location

3'UTR (cg23561148)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:9.57E-10; Z-score:1.69E+00

Methylation in Case

8.26E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A6 in bladder cancer [ 3 ]

Location

3'UTR (cg23561148)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.73E+00 Statistic Test p-value:2.49E-11; Z-score:-1.06E+01

Methylation in Case

4.58E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A6 in breast cancer [ 4 ]

Location

3'UTR (cg23561148)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.61E-06; Z-score:-6.97E-01

Methylation in Case

8.25E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A6 in colorectal cancer [ 5 ]

Location

3'UTR (cg23561148)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:9.94E-05; Z-score:1.32E+00

Methylation in Case

9.10E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A6 in panic disorder [ 6 ]

Location

3'UTR (cg23561148)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-7.42E-01 Statistic Test p-value:9.19E-03; Z-score:-3.77E-01

Methylation in Case

-4.80E-01 (Median) Methylation in Control -3.57E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC39A6 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.01E-25; Fold-change:-0.539483568; Z-score:-10.26774143
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Diffuse midline glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC39A6 in diffuse midline glioma than that in healthy individual

Studied Phenotype

Diffuse midline glioma [ICD-11:2A00.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.14E-32; Fold-change:-0.30182044; Z-score:-7.184616506
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC39A6 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.003753692; Fold-change:-0.420622655; Z-score:-39.62469515
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-101 directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-101 miRNA Mature ID miR-101-3p

miRNA Sequence

UACAGUACUGUGAUAACUGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-126 directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-126 miRNA Mature ID miR-126-3p

miRNA Sequence

UCGUACCGUGAGUAAUAAUGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-135a directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-135a miRNA Mature ID miR-135a-5p

miRNA Sequence

UAUGGCUUUUUAUUCCUAUGUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-135b directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-135b miRNA Mature ID miR-135b-5p

miRNA Sequence

UAUGGCUUUUCAUUCCUAUGUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-139 directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-139 miRNA Mature ID miR-139-5p

miRNA Sequence

UCUACAGUGCACGUGUCUCCAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-144 directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-144 miRNA Mature ID miR-144-3p

miRNA Sequence

UACAGUAUAGAUGAUGUACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-26b directly targets SLC39A6 [ 8 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon8

miR-3163 directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3163 miRNA Mature ID miR-3163

miRNA Sequence

UAUAAAAUGAGGGCAGUAAGAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-32 directly targets SLC39A6 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-32 miRNA Mature ID miR-32-5p

miRNA Sequence

UAUUGCACAUUACUAAGUUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-323a directly targets SLC39A6 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-323a miRNA Mature ID miR-323a-5p

miRNA Sequence

AGGUGGUCCGUGGCGCGUUCGC

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

miR-410 directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-410 miRNA Mature ID miR-410-3p

miRNA Sequence

AAUAUAACACAGAUGGCCUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-539 directly targets SLC39A6 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-539 miRNA Mature ID miR-539-5p

miRNA Sequence

GGAGAAAUUAUCCUUGGUGUGU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

miR-548v directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548v miRNA Mature ID miR-548v

miRNA Sequence

AGCUACAGUUACUUUUGCACCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

miR-7849 directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7849 miRNA Mature ID miR-7849-3p

miRNA Sequence

GACAAUUGUUGAUCUUGGGCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

miR-889 directly targets SLC39A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-889 miRNA Mature ID miR-889-5p

miRNA Sequence

AAUGGCUGUCCGUAGUAUGGUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-92a directly targets SLC39A6 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-92b directly targets SLC39A6 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-92b miRNA Mature ID miR-92b-3p

miRNA Sequence

UAUUGCACUCGUCCCGGCCUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
8 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
9 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
10 Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.