General Information of Drug Transporter (DT)
DT ID DTD0342 Transporter Info
Gene Name SLC39A14
Transporter Name Zinc transporter ZIP14
Gene ID
23516
UniProt ID
Q15043
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A14 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg26855219)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.58E+00 Statistic Test p-value:1.26E-09; Z-score:1.50E+00

Methylation in Case

2.58E-01 (Median) Methylation in Control 1.64E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A14 in bladder cancer [ 2 ]

Location

Body (cg18042586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:5.75E-04; Z-score:-2.97E+00

Methylation in Case

4.43E-01 (Median) Methylation in Control 5.49E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A14 in bladder cancer [ 2 ]

Location

Body (cg24136932)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.12E-02; Z-score:-8.43E-01

Methylation in Case

7.31E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A14 in breast cancer [ 3 ]

Location

Body (cg24136932)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:8.93E-06; Z-score:-9.00E-01

Methylation in Case

7.95E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A14 in colorectal cancer [ 4 ]

Location

Body (cg24136932)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.44E-02; Z-score:3.84E-01

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A14 in HIV infection [ 5 ]

Location

Body (cg18042586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:9.39E-08; Z-score:1.83E+00

Methylation in Case

6.06E-01 (Median) Methylation in Control 5.30E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A14 in papillary thyroid cancer [ 6 ]

Location

Body (cg18042586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:5.57E-03; Z-score:6.45E-01

Methylation in Case

5.91E-01 (Median) Methylation in Control 5.76E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         20 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1 directly targets SLC39A14 [ 7 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

miR-155 directly targets SLC39A14 [ 7 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-155 miRNA Mature ID miR-155-5p

miRNA Sequence

UUAAUGCUAAUCGUGAUAGGGGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon3

miR-15b directly targets SLC39A14 [ 8 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-16 directly targets SLC39A14 [ 7 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon5

miR-205 directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-205 miRNA Mature ID miR-205-5p

miRNA Sequence

UCCUUCAUUCCACCGGAGUCUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-25 directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-25 miRNA Mature ID miR-25-3p

miRNA Sequence

CAUUGCACUUGUCUCGGUCUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-3140 directly targets SLC39A14 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3140 miRNA Mature ID miR-3140-5p

miRNA Sequence

ACCUGAAUUACCAAAAGCUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-32 directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-32 miRNA Mature ID miR-32-5p

miRNA Sequence

UAUUGCACAUUACUAAGUUGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-33a directly targets SLC39A14 [ 11 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-33a miRNA Mature ID miR-33a-5p

miRNA Sequence

GUGCAUUGUAGUUGCAUUGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-3614 directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3614 miRNA Mature ID miR-3614-3p

miRNA Sequence

UAGCCUUCAGAUCUUGGUGUUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-363 directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-363 miRNA Mature ID miR-363-3p

miRNA Sequence

AAUUGCACGGUAUCCAUCUGUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-367 directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-367 miRNA Mature ID miR-367-3p

miRNA Sequence

AAUUGCACUUUAGCAAUGGUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-4729 directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4729 miRNA Mature ID miR-4729

miRNA Sequence

UCAUUUAUCUGUUGGGAAGCUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

miR-4766 directly targets SLC39A14 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4766 miRNA Mature ID miR-4766-5p

miRNA Sequence

UCUGAAAGAGCAGUUGGUGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

miR-539 directly targets SLC39A14 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-539 miRNA Mature ID miR-539-5p

miRNA Sequence

GGAGAAAUUAUCCUUGGUGUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-580 directly targets SLC39A14 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-580 miRNA Mature ID miR-580-3p

miRNA Sequence

UUGAGAAUGAUGAAUCAUUAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-646 directly targets SLC39A14 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-646 miRNA Mature ID miR-646

miRNA Sequence

AAGCAGCUGCCUCUGAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-9 directly targets SLC39A14 [ 12 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-9 miRNA Mature ID miR-9-5p

miRNA Sequence

UCUUUGGUUAUCUAGCUGUAUGA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon19

miR-92a directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

miR-92b directly targets SLC39A14 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-92b miRNA Mature ID miR-92b-3p

miRNA Sequence

UAUUGCACUCGUCCCGGCCUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
8 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
9 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
10 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
11 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
12 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.