Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0342 Transporter Info | ||||
Gene Name | SLC39A14 | ||||
Transporter Name | Zinc transporter ZIP14 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC39A14 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg26855219) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.58E+00 | Statistic Test | p-value:1.26E-09; Z-score:1.50E+00 | ||
Methylation in Case |
2.58E-01 (Median) | Methylation in Control | 1.64E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC39A14 in bladder cancer | [ 2 ] | |||
Location |
Body (cg18042586) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:5.75E-04; Z-score:-2.97E+00 | ||
Methylation in Case |
4.43E-01 (Median) | Methylation in Control | 5.49E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC39A14 in bladder cancer | [ 2 ] | |||
Location |
Body (cg24136932) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:3.12E-02; Z-score:-8.43E-01 | ||
Methylation in Case |
7.31E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC39A14 in breast cancer | [ 3 ] | |||
Location |
Body (cg24136932) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:8.93E-06; Z-score:-9.00E-01 | ||
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.61E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC39A14 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg24136932) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:2.44E-02; Z-score:3.84E-01 | ||
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC39A14 in HIV infection | [ 5 ] | |||
Location |
Body (cg18042586) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:9.39E-08; Z-score:1.83E+00 | ||
Methylation in Case |
6.06E-01 (Median) | Methylation in Control | 5.30E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC39A14 in papillary thyroid cancer | [ 6 ] | |||
Location |
Body (cg18042586) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:5.57E-03; Z-score:6.45E-01 | ||
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 5.76E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-1 directly targets SLC39A14 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon2 |
miR-155 directly targets SLC39A14 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon3 |
miR-15b directly targets SLC39A14 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon4 |
miR-16 directly targets SLC39A14 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon5 |
miR-205 directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-205 | miRNA Mature ID | miR-205-5p | ||
miRNA Sequence |
UCCUUCAUUCCACCGGAGUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon6 |
miR-25 directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-25 | miRNA Mature ID | miR-25-3p | ||
miRNA Sequence |
CAUUGCACUUGUCUCGGUCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon7 |
miR-3140 directly targets SLC39A14 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3140 | miRNA Mature ID | miR-3140-5p | ||
miRNA Sequence |
ACCUGAAUUACCAAAAGCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon8 |
miR-32 directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-32 | miRNA Mature ID | miR-32-5p | ||
miRNA Sequence |
UAUUGCACAUUACUAAGUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon9 |
miR-33a directly targets SLC39A14 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
miRNA Stemloop ID |
miR-33a | miRNA Mature ID | miR-33a-5p | ||
miRNA Sequence |
GUGCAUUGUAGUUGCAUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon10 |
miR-3614 directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3614 | miRNA Mature ID | miR-3614-3p | ||
miRNA Sequence |
UAGCCUUCAGAUCUUGGUGUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon11 |
miR-363 directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-363 | miRNA Mature ID | miR-363-3p | ||
miRNA Sequence |
AAUUGCACGGUAUCCAUCUGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon12 |
miR-367 directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-367 | miRNA Mature ID | miR-367-3p | ||
miRNA Sequence |
AAUUGCACUUUAGCAAUGGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon13 |
miR-4729 directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4729 | miRNA Mature ID | miR-4729 | ||
miRNA Sequence |
UCAUUUAUCUGUUGGGAAGCUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon14 |
miR-4766 directly targets SLC39A14 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4766 | miRNA Mature ID | miR-4766-5p | ||
miRNA Sequence |
UCUGAAAGAGCAGUUGGUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon15 |
miR-539 directly targets SLC39A14 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-539 | miRNA Mature ID | miR-539-5p | ||
miRNA Sequence |
GGAGAAAUUAUCCUUGGUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon16 |
miR-580 directly targets SLC39A14 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-580 | miRNA Mature ID | miR-580-3p | ||
miRNA Sequence |
UUGAGAAUGAUGAAUCAUUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon17 |
miR-646 directly targets SLC39A14 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-646 | miRNA Mature ID | miR-646 | ||
miRNA Sequence |
AAGCAGCUGCCUCUGAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon18 |
miR-9 directly targets SLC39A14 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-9 | miRNA Mature ID | miR-9-5p | ||
miRNA Sequence |
UCUUUGGUUAUCUAGCUGUAUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon19 |
miR-92a directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon20 |
miR-92b directly targets SLC39A14 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-3p | ||
miRNA Sequence |
UAUUGCACUCGUCCCGGCCUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.