General Information of Drug Transporter (DT)
DT ID DTD0341 Transporter Info
Gene Name SLC39A13
Transporter Name Zinc transporter ZIP13
Gene ID
91252
UniProt ID
Q96H72
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1225 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1225 miRNA Mature ID miR-1225-3p

miRNA Sequence

UGAGCCCCUGUGCCGCCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1233 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1233 miRNA Mature ID miR-1233-3p

miRNA Sequence

UGAGCCCUGUCCUCCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-18a directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-18a miRNA Mature ID miR-18a-3p

miRNA Sequence

ACUGCCCUAAGUGCUCCUUCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-2355 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2355 miRNA Mature ID miR-2355-5p

miRNA Sequence

AUCCCCAGAUACAAUGGACAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-3943 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3943 miRNA Mature ID miR-3943

miRNA Sequence

UAGCCCCCAGGCUUCACUUGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-4286 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4286 miRNA Mature ID miR-4286

miRNA Sequence

ACCCCACUCCUGGUACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-4313 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4313 miRNA Mature ID miR-4313

miRNA Sequence

AGCCCCCUGGCCCCAAACCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-484 directly targets SLC39A13 [ 2 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-484 miRNA Mature ID miR-484

miRNA Sequence

UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-6734 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6734 miRNA Mature ID miR-6734-3p

miRNA Sequence

CCCUUCCCUCACUCUUCUCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-6752 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6752 miRNA Mature ID miR-6752-3p

miRNA Sequence

UCCCUGCCCCCAUACUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-6801 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6801 miRNA Mature ID miR-6801-3p

miRNA Sequence

ACCCCUGCCACUCACUGGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-6810 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6810 miRNA Mature ID miR-6810-3p

miRNA Sequence

UCCCCUGCUCCCUUGUUCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-6886 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6886 miRNA Mature ID miR-6886-3p

miRNA Sequence

UGCCCUUCUCUCCUCCUGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-938 directly targets SLC39A13 [ 1 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-938 miRNA Mature ID miR-938

miRNA Sequence

UGCCCUUAAAGGUGAACCCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Cerebellar liponeurocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC39A13 in cerebellar liponeurocytoma than that in healthy individual

Studied Phenotype

Cerebellar liponeurocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.00084575; Fold-change:-0.214684362; Z-score:-6.087604965
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC39A13 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.10E-14; Fold-change:-0.453294648; Z-score:-11.94747273
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
2 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.