Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0341 Transporter Info | ||||
| Gene Name | SLC39A13 | ||||
| Transporter Name | Zinc transporter ZIP13 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1225 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1225 | miRNA Mature ID | miR-1225-3p | ||
|
miRNA Sequence |
UGAGCCCCUGUGCCGCCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1233 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1233 | miRNA Mature ID | miR-1233-3p | ||
|
miRNA Sequence |
UGAGCCCUGUCCUCCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-18a directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-18a | miRNA Mature ID | miR-18a-3p | ||
|
miRNA Sequence |
ACUGCCCUAAGUGCUCCUUCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-2355 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2355 | miRNA Mature ID | miR-2355-5p | ||
|
miRNA Sequence |
AUCCCCAGAUACAAUGGACAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-3943 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3943 | miRNA Mature ID | miR-3943 | ||
|
miRNA Sequence |
UAGCCCCCAGGCUUCACUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-4286 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4286 | miRNA Mature ID | miR-4286 | ||
|
miRNA Sequence |
ACCCCACUCCUGGUACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-4313 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4313 | miRNA Mature ID | miR-4313 | ||
|
miRNA Sequence |
AGCCCCCUGGCCCCAAACCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-484 directly targets SLC39A13 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-484 | miRNA Mature ID | miR-484 | ||
|
miRNA Sequence |
UCAGGCUCAGUCCCCUCCCGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-6734 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6734 | miRNA Mature ID | miR-6734-3p | ||
|
miRNA Sequence |
CCCUUCCCUCACUCUUCUCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-6752 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6752 | miRNA Mature ID | miR-6752-3p | ||
|
miRNA Sequence |
UCCCUGCCCCCAUACUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-6801 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6801 | miRNA Mature ID | miR-6801-3p | ||
|
miRNA Sequence |
ACCCCUGCCACUCACUGGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-6810 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6810 | miRNA Mature ID | miR-6810-3p | ||
|
miRNA Sequence |
UCCCCUGCUCCCUUGUUCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-6886 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6886 | miRNA Mature ID | miR-6886-3p | ||
|
miRNA Sequence |
UGCCCUUCUCUCCUCCUGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-938 directly targets SLC39A13 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-938 | miRNA Mature ID | miR-938 | ||
|
miRNA Sequence |
UGCCCUUAAAGGUGAACCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
|
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC39A13 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.00084575; Fold-change:-0.214684362; Z-score:-6.087604965 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC39A13 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:9.10E-14; Fold-change:-0.453294648; Z-score:-11.94747273 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples