General Information of Drug Transporter (DT)
DT ID DTD0340 Transporter Info
Gene Name SLC39A12
Transporter Name Zinc transporter ZIP12
Gene ID
221074
UniProt ID
Q504Y0
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-335 directly targets SLC39A12 [ 1 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Liver cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant/significant hypermethylation of SLC39A12 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.04E-05; Fold-change:-0.533239257; Z-score:-1.312540043

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:7.98E-22; Fold-change:-0.530778583; Z-score:-5.493836972
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Melanocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC39A12 in melanocytoma than that in healthy individual

Studied Phenotype

Melanocytoma [ICD-11:2F36.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.005236847; Fold-change:0.268692544; Z-score:1.071928819
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Esthesioneuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC39A12 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.07E-09; Fold-change:-0.278409532; Z-score:-4.299163713
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Ovarian cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC39A12 in ovarian cancer than that in healthy individual

Studied Phenotype

Ovarian cancer [ICD-11:2C73]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.007008701; Fold-change:-0.229390013; Z-score:-0.988024953
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Medulloblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC39A12 in medulloblastoma than that in healthy individual

Studied Phenotype

Medulloblastoma [ICD-11:2A00.10]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.29E-44; Fold-change:0.442248755; Z-score:2.459777053
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Meningioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC39A12 in meningioma than that in healthy individual

Studied Phenotype

Meningioma [ICD-11:2A01.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:8.27E-50; Fold-change:0.387698666; Z-score:2.115105399
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC39A12 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.57E-20; Fold-change:-0.554433153; Z-score:-9.642672808
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Uterine carcinosarcoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC39A12 in uterine carcinosarcoma than that in healthy individual

Studied Phenotype

Uterine carcinosarcoma [ICD-11:2B5F]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.003403225; Fold-change:-0.324159984; Z-score:-1.392010996
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.