Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0338 Transporter Info | ||||
| Gene Name | SLC39A10 | ||||
| Transporter Name | Zinc transporter ZIP10 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-103a directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-103a | miRNA Mature ID | miR-103a-3p | ||
|
miRNA Sequence |
AGCAGCAUUGUACAGGGCUAUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
miR-1252 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1252 | miRNA Mature ID | miR-1252-3p | ||
|
miRNA Sequence |
CAAAUGAGCUUAAUUUCCUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-140 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-140 | miRNA Mature ID | miR-140-3p | ||
|
miRNA Sequence |
UACCACAGGGUAGAACCACGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-155 directly targets SLC39A10 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
|
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human peripheral blood mononuclear cells | ||||
|
Epigenetic Phenomenon5 |
miR-16 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
|
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon6 |
miR-186 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-5p | ||
|
miRNA Sequence |
CAAAGAAUUCUCCUUUUGGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon7 |
miR-218 directly targets SLC39A10 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-218 | miRNA Mature ID | miR-218-5p | ||
|
miRNA Sequence |
UUGUGCUUGAUCUAACCAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-221 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-221 | miRNA Mature ID | miR-221-5p | ||
|
miRNA Sequence |
ACCUGGCAUACAAUGUAGAUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-3128 directly targets SLC39A10 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3128 | miRNA Mature ID | miR-3128 | ||
|
miRNA Sequence |
UCUGGCAAGUAAAAAACUCUCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-324 directly targets SLC39A10 | [ 5 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-324 | miRNA Mature ID | miR-324-5p | ||
|
miRNA Sequence |
CGCAUCCCCUAGGGCAUUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon11 |
miR-3646 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3646 | miRNA Mature ID | miR-3646 | ||
|
miRNA Sequence |
AAAAUGAAAUGAGCCCAGCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon12 |
miR-4287 directly targets SLC39A10 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4287 | miRNA Mature ID | miR-4287 | ||
|
miRNA Sequence |
UCUCCCUUGAGGGCACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-4685 directly targets SLC39A10 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4685 | miRNA Mature ID | miR-4685-3p | ||
|
miRNA Sequence |
UCUCCCUUCCUGCCCUGGCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-4720 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4720 | miRNA Mature ID | miR-4720-5p | ||
|
miRNA Sequence |
CCUGGCAUAUUUGGUAUAACUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon15 |
miR-4780 directly targets SLC39A10 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4780 | miRNA Mature ID | miR-4780 | ||
|
miRNA Sequence |
ACCCUUGAGCCUGAUCCCUAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-4799 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4799 | miRNA Mature ID | miR-4799-3p | ||
|
miRNA Sequence |
ACUGGCAUGCUGCAUUUAUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon17 |
miR-5588 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5588 | miRNA Mature ID | miR-5588-5p | ||
|
miRNA Sequence |
ACUGGCAUUAGUGGGACUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon18 |
miR-5689 directly targets SLC39A10 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5689 | miRNA Mature ID | miR-5689 | ||
|
miRNA Sequence |
AGCAUACACCUGUAGUCCUAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-582 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-582 | miRNA Mature ID | miR-582-5p | ||
|
miRNA Sequence |
UUACAGUUGUUCAACCAGUUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon20 |
miR-591 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-591 | miRNA Mature ID | miR-591 | ||
|
miRNA Sequence |
AGACCAUGGGUUCUCAUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon21 |
miR-619 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-3p | ||
|
miRNA Sequence |
GACCUGGACAUGUUUGUGCCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon22 |
miR-623 directly targets SLC39A10 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-623 | miRNA Mature ID | miR-623 | ||
|
miRNA Sequence |
AUCCCUUGCAGGGGCUGUUGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon23 |
miR-6502 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6502 | miRNA Mature ID | miR-6502-3p | ||
|
miRNA Sequence |
UAGACCAUCUUUCUAGAGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon24 |
miR-7106 directly targets SLC39A10 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-3p | ||
|
miRNA Sequence |
AGCUCCCUGAAUCCCUGUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon25 |
miR-7851 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7851 | miRNA Mature ID | miR-7851-3p | ||
|
miRNA Sequence |
UACCUGGGAGACUGAGGUUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon26 |
miR-8073 directly targets SLC39A10 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8073 | miRNA Mature ID | miR-8073 | ||
|
miRNA Sequence |
ACCUGGCAGCAGGGAGCGUCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.