General Information of Drug Transporter (DT)
DT ID DTD0336 Transporter Info
Gene Name SLC38A9
Transporter Name Sodium-coupled neutral amino acid transporter 9
Gene ID
153129
UniProt ID
Q8NBW4
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg04401436)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:3.15E-08; Z-score:-1.37E+00

Methylation in Case

8.34E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg05146599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.86E+00 Statistic Test p-value:4.49E-08; Z-score:-2.11E+00

Methylation in Case

1.31E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg13598790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:5.80E-07; Z-score:1.11E+00

Methylation in Case

9.41E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg18034294)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:2.21E-06; Z-score:-1.28E+00

Methylation in Case

5.29E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg05462905)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.48E-03; Z-score:-6.64E-01

Methylation in Case

8.53E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg07042489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.30E-03; Z-score:-7.56E-01

Methylation in Case

8.63E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg07262873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.73E-03; Z-score:-5.05E-01

Methylation in Case

7.92E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A9 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg13589588)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.72E-02; Z-score:3.98E-01

Methylation in Case

8.99E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

5'UTR (cg05146599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.47E-04; Z-score:-5.62E+00

Methylation in Case

7.38E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

5'UTR (cg13598790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.75E-02; Z-score:-1.07E+00

Methylation in Case

3.81E-02 (Median) Methylation in Control 4.36E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

5'UTR (cg18034294)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.35E-02; Z-score:-1.23E+00

Methylation in Case

8.69E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

TSS1500 (cg11493924)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:5.09E-04; Z-score:-2.71E+00

Methylation in Case

5.86E-02 (Median) Methylation in Control 7.24E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

TSS1500 (cg11466815)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:3.93E-02; Z-score:-1.09E+00

Methylation in Case

1.83E-02 (Median) Methylation in Control 2.21E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

TSS200 (cg10968375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.44E+00 Statistic Test p-value:2.42E-02; Z-score:-1.20E+00

Methylation in Case

2.01E-02 (Median) Methylation in Control 2.89E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

Body (cg07042489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.45E-03; Z-score:-3.55E+00

Methylation in Case

8.53E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

Body (cg05462905)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:2.27E-03; Z-score:-2.88E+00

Methylation in Case

6.73E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

Body (cg24749564)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.29E-03; Z-score:2.20E+00

Methylation in Case

8.16E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

Body (cg27622900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:7.90E-03; Z-score:-1.89E+00

Methylation in Case

7.82E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC38A9 in bladder cancer [ 2 ]

Location

Body (cg26540004)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.27E-02; Z-score:9.31E-01

Methylation in Case

4.28E-01 (Median) Methylation in Control 3.84E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

5'UTR (cg05146599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:8.04E-05; Z-score:1.55E+00

Methylation in Case

8.30E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

5'UTR (cg18034294)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.23E-03; Z-score:-4.28E-01

Methylation in Case

8.81E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

5'UTR (cg13598790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:4.07E-02; Z-score:-4.33E-01

Methylation in Case

2.77E-02 (Median) Methylation in Control 3.10E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

TSS1500 (cg11493924)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:8.90E-03; Z-score:-3.30E-01

Methylation in Case

5.87E-02 (Median) Methylation in Control 6.68E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

TSS1500 (cg09277365)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:4.36E-02; Z-score:-5.28E-01

Methylation in Case

4.80E-02 (Median) Methylation in Control 5.58E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

TSS200 (cg10968375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:3.13E-02; Z-score:-5.84E-01

Methylation in Case

9.94E-03 (Median) Methylation in Control 1.40E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

TSS200 (cg12824106)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:3.20E-02; Z-score:-3.71E-01

Methylation in Case

5.80E-03 (Median) Methylation in Control 7.47E-03 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

Body (cg07262873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.78E+00 Statistic Test p-value:1.47E-18; Z-score:3.24E+00

Methylation in Case

4.35E-01 (Median) Methylation in Control 2.44E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

Body (cg07042489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.60E-04; Z-score:-7.83E-01

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

Body (cg26540004)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:2.58E-03; Z-score:9.00E-01

Methylation in Case

4.77E-01 (Median) Methylation in Control 4.12E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

Body (cg13589588)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:6.19E-03; Z-score:-6.61E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

Body (cg27622900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.53E-03; Z-score:-7.33E-01

Methylation in Case

7.71E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC38A9 in breast cancer [ 3 ]

Location

Body (cg24749564)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.76E-02; Z-score:4.40E-01

Methylation in Case

7.99E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg04401436)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.68E-02; Z-score:3.05E-01

Methylation in Case

2.71E-02 (Median) Methylation in Control 2.54E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg11466815)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:9.07E-03; Z-score:5.38E-01

Methylation in Case

2.52E-02 (Median) Methylation in Control 2.40E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg11283154)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:8.79E-03; Z-score:6.50E-01

Methylation in Case

2.36E-02 (Median) Methylation in Control 2.23E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg07397574)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.53E-02; Z-score:2.82E-01

Methylation in Case

1.72E-02 (Median) Methylation in Control 1.67E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg12824106)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.68E-02; Z-score:1.93E-01

Methylation in Case

1.09E-02 (Median) Methylation in Control 1.07E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg09554558)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.08E-02; Z-score:3.25E-01

Methylation in Case

1.36E-02 (Median) Methylation in Control 1.30E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A9 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg10968375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.09E-02; Z-score:5.38E-01

Methylation in Case

1.32E-02 (Median) Methylation in Control 1.23E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

5'UTR (cg13598790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.64E-03; Z-score:6.53E-01

Methylation in Case

2.01E-02 (Median) Methylation in Control 1.77E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

TSS200 (cg10968375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:2.45E-03; Z-score:5.68E-01

Methylation in Case

1.10E-02 (Median) Methylation in Control 9.34E-03 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

TSS200 (cg09200496)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.94E-02; Z-score:-5.35E-01

Methylation in Case

1.07E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

Body (cg27622900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.29E-06; Z-score:-1.59E+00

Methylation in Case

8.49E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in colorectal cancer [ 5 ]

Location

Body (cg07262873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:1.30E-05; Z-score:1.36E+00

Methylation in Case

6.52E-01 (Median) Methylation in Control 5.40E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

5'UTR (cg05146599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.00E-05; Z-score:-1.17E+00

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

Body (cg26540004)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.42E+00 Statistic Test p-value:4.51E-08; Z-score:-1.36E+00

Methylation in Case

2.59E-01 (Median) Methylation in Control 3.67E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

Body (cg07042489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:4.51E-08; Z-score:-1.35E+00

Methylation in Case

7.51E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

Body (cg07262873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.46E+00 Statistic Test p-value:4.44E-07; Z-score:-1.44E+00

Methylation in Case

2.37E-01 (Median) Methylation in Control 3.46E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in hepatocellular carcinoma [ 6 ]

Location

Body (cg24749564)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.05E-03; Z-score:-4.70E-01

Methylation in Case

8.04E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in HIV infection [ 7 ]

Location

5'UTR (cg18034294)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.33E-02; Z-score:7.86E-01

Methylation in Case

9.52E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in HIV infection [ 7 ]

Location

TSS1500 (cg11493924)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.34E-02; Z-score:5.97E-01

Methylation in Case

6.95E-02 (Median) Methylation in Control 6.16E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in HIV infection [ 7 ]

Location

TSS1500 (cg03329536)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.50E-02; Z-score:-3.25E-01

Methylation in Case

5.34E-02 (Median) Methylation in Control 5.71E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in HIV infection [ 7 ]

Location

TSS200 (cg12824106)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.56E+00 Statistic Test p-value:6.35E-03; Z-score:7.59E-01

Methylation in Case

7.25E-03 (Median) Methylation in Control 4.66E-03 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in HIV infection [ 7 ]

Location

TSS200 (cg11283154)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.48E+00 Statistic Test p-value:3.35E-02; Z-score:7.00E-01

Methylation in Case

1.38E-02 (Median) Methylation in Control 9.37E-03 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A9 in HIV infection [ 7 ]

Location

Body (cg26540004)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:3.40E-06; Z-score:1.94E+00

Methylation in Case

7.94E-01 (Median) Methylation in Control 6.77E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A9 in HIV infection [ 7 ]

Location

Body (cg27622900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.08E-03; Z-score:6.29E-01

Methylation in Case

8.78E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A9 in HIV infection [ 7 ]

Location

Body (cg07262873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.24E-02; Z-score:3.12E-01

Methylation in Case

7.81E-01 (Median) Methylation in Control 7.67E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

5'UTR (cg21660392)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.11E-03; Z-score:-7.19E-01

Methylation in Case

7.54E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

5'UTR (cg08240652)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.67E-03; Z-score:1.19E+00

Methylation in Case

8.54E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

5'UTR (cg12484332)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.95E-02; Z-score:-1.51E-01

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

TSS1500 (cg13161658)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.02E+00 Statistic Test p-value:1.38E-05; Z-score:1.43E+00

Methylation in Case

3.23E-01 (Median) Methylation in Control 1.60E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

TSS1500 (cg18584905)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:1.89E-02; Z-score:-1.22E+00

Methylation in Case

1.75E-01 (Median) Methylation in Control 2.21E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

TSS1500 (cg03483626)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.09E-02; Z-score:3.87E-01

Methylation in Case

5.28E-01 (Median) Methylation in Control 5.06E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

TSS200 (cg22364668)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.71E-07; Z-score:2.89E-01

Methylation in Case

4.90E-02 (Median) Methylation in Control 4.57E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

TSS200 (cg17344085)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.33E-02; Z-score:-5.96E-01

Methylation in Case

3.03E-02 (Median) Methylation in Control 3.37E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg03067613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:8.57E-05; Z-score:1.25E+00

Methylation in Case

8.43E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg15531450)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:3.16E-04; Z-score:9.13E-01

Methylation in Case

5.40E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg02793733)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.77E-03; Z-score:-2.91E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg19503341)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.09E-02; Z-score:7.48E-01

Methylation in Case

4.87E-01 (Median) Methylation in Control 4.56E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC38A9 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg17461670)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.32E-02; Z-score:-3.69E-01

Methylation in Case

8.63E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in systemic lupus erythematosus [ 9 ]

Location

5'UTR (cg04401436)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.77E-02; Z-score:-7.40E-02

Methylation in Case

9.11E-02 (Median) Methylation in Control 9.25E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in systemic lupus erythematosus [ 9 ]

Location

TSS1500 (cg09277365)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.38E-02; Z-score:-1.09E-01

Methylation in Case

7.65E-02 (Median) Methylation in Control 7.87E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in systemic lupus erythematosus [ 9 ]

Location

TSS200 (cg21173440)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.44E-02; Z-score:5.96E-02

Methylation in Case

1.86E-01 (Median) Methylation in Control 1.85E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in systemic lupus erythematosus [ 9 ]

Location

Body (cg27622900)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:8.30E-03; Z-score:-2.90E-01

Methylation in Case

8.57E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Colon cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in colon adenocarcinoma [ 10 ]

Location

TSS1500 (cg11826452)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.30E-03; Z-score:-8.62E-01

Methylation in Case

4.82E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in colon adenocarcinoma [ 10 ]

Location

TSS1500 (cg14282904)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.46E+00 Statistic Test p-value:1.36E-03; Z-score:1.95E+00

Methylation in Case

1.95E-01 (Median) Methylation in Control 7.92E-02 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in colon adenocarcinoma [ 10 ]

Location

1stExon (cg16163981)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:3.89E-03; Z-score:1.12E+00

Methylation in Case

4.27E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in colon adenocarcinoma [ 10 ]

Location

3'UTR (cg03954999)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.26E-03; Z-score:-2.94E+00

Methylation in Case

7.32E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

TSS1500 (cg11493924)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:7.53E-08; Z-score:-8.60E-01

Methylation in Case

6.67E-02 (Median) Methylation in Control 8.28E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

TSS1500 (cg09277365)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.12E-03; Z-score:-4.30E-01

Methylation in Case

5.72E-02 (Median) Methylation in Control 6.31E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

TSS1500 (cg03329536)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.74E-02; Z-score:-6.27E-01

Methylation in Case

5.71E-02 (Median) Methylation in Control 6.24E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

TSS200 (cg10968375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:3.43E-05; Z-score:-6.86E-01

Methylation in Case

4.54E-02 (Median) Methylation in Control 5.02E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

TSS200 (cg09554558)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.51E-03; Z-score:-6.57E-01

Methylation in Case

4.70E-02 (Median) Methylation in Control 5.10E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

Body (cg26540004)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:1.78E-20; Z-score:-4.54E+00

Methylation in Case

4.91E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

Body (cg24749564)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.06E-07; Z-score:-1.27E+00

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

Body (cg05462905)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.73E-03; Z-score:-5.69E-01

Methylation in Case

8.80E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC38A9 in papillary thyroid cancer [ 11 ]

Location

Body (cg07262873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.72E-02; Z-score:3.77E-01

Methylation in Case

4.02E-01 (Median) Methylation in Control 3.79E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in prostate cancer [ 12 ]

Location

TSS200 (cg07920064)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:1.44E-03; Z-score:3.39E+00

Methylation in Case

4.96E-02 (Median) Methylation in Control 3.51E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A9 in prostate cancer [ 12 ]

Location

Body (cg00502885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:6.64E-04; Z-score:5.27E+00

Methylation in Case

9.14E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A9 in prostate cancer [ 12 ]

Location

Body (cg10062193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.92E+00 Statistic Test p-value:7.22E-04; Z-score:5.15E+00

Methylation in Case

7.96E-01 (Median) Methylation in Control 2.72E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A9 in prostate cancer [ 12 ]

Location

3'UTR (cg03825810)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.64E+00 Statistic Test p-value:5.06E-03; Z-score:-6.52E+00

Methylation in Case

5.14E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in lung adenocarcinoma [ 13 ]

Location

Body (cg07262873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:1.10E-03; Z-score:2.95E+00

Methylation in Case

6.01E-01 (Median) Methylation in Control 4.56E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A9 in panic disorder [ 14 ]

Location

Body (cg05462905)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:7.29E-03; Z-score:-2.28E-01

Methylation in Case

5.42E-01 (Median) Methylation in Control 6.35E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         72 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-106a directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-106a miRNA Mature ID miR-106a-3p

miRNA Sequence

CUGCAAUGUAAGCACUUCUUAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-122 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-125a directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-125a miRNA Mature ID miR-125a-3p

miRNA Sequence

ACAGGUGAGGUUCUUGGGAGCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-1264 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1264 miRNA Mature ID miR-1264

miRNA Sequence

CAAGUCUUAUUUGAGCACCUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-129 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1304 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-130a directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-130a miRNA Mature ID miR-130a-3p

miRNA Sequence

CAGUGCAAUGUUAAAAGGGCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-130b directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-130b miRNA Mature ID miR-130b-3p

miRNA Sequence

CAGUGCAAUGAUGAAAGGGCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-145 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-145 miRNA Mature ID miR-145-3p

miRNA Sequence

GGAUUCCUGGAAAUACUGUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-183 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-183 miRNA Mature ID miR-183-5p

miRNA Sequence

UAUGGCACUGGUAGAAUUCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-1911 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1911 miRNA Mature ID miR-1911-5p

miRNA Sequence

UGAGUACCGCCAUGUCUGUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-1972 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1972 miRNA Mature ID miR-1972

miRNA Sequence

UCAGGCCAGGCACAGUGGCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-1976 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-2113 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2113 miRNA Mature ID miR-2113

miRNA Sequence

AUUUGUGCUUGGCUCUGUCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-24-1 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-24-1 miRNA Mature ID miR-24-1-5p

miRNA Sequence

UGCCUACUGAGCUGAUAUCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-24-2 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-24-2 miRNA Mature ID miR-24-2-5p

miRNA Sequence

UGCCUACUGAGCUGAAACACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-301a directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-301a miRNA Mature ID miR-301a-3p

miRNA Sequence

CAGUGCAAUAGUAUUGUCAAAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-301b directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-301b miRNA Mature ID miR-301b-3p

miRNA Sequence

CAGUGCAAUGAUAUUGUCAAAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-3135b directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-3194 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3194 miRNA Mature ID miR-3194-5p

miRNA Sequence

GGCCAGCCACCAGGAGGGCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-330 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-330 miRNA Mature ID miR-330-3p

miRNA Sequence

GCAAAGCACACGGCCUGCAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-3652 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

CGGCUGGAGGUGUGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-3654 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3654 miRNA Mature ID miR-3654

miRNA Sequence

GACUGGACAAGCUGAGGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-3666 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3666 miRNA Mature ID miR-3666

miRNA Sequence

CAGUGCAAGUGUAGAUGCCGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-3675 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3675 miRNA Mature ID miR-3675-3p

miRNA Sequence

CAUCUCUAAGGAACUCCCCCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-371a directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-371a miRNA Mature ID miR-371a-5p

miRNA Sequence

ACUCAAACUGUGGGGGCACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-371b directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-372 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-372 miRNA Mature ID miR-372-5p

miRNA Sequence

CCUCAAAUGUGGAGCACUAUUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-373 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-3934 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3934 miRNA Mature ID miR-3934-5p

miRNA Sequence

UCAGGUGUGGAAACUGAGGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon31

miR-4295 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4295 miRNA Mature ID miR-4295

miRNA Sequence

CAGUGCAAUGUUUUCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-4430 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

AGGCUGGAGUGAGCGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-4474 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4474 miRNA Mature ID miR-4474-5p

miRNA Sequence

UUAGUCUCAUGAUCAGACACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon34

miR-4520 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4520 miRNA Mature ID miR-4520-3p

miRNA Sequence

UUGGACAGAAAACACGCAGGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-454 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-454 miRNA Mature ID miR-454-3p

miRNA Sequence

UAGUGCAAUAUUGCUUAUAGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-4638 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4638 miRNA Mature ID miR-4638-3p

miRNA Sequence

CCUGGACACCGCUCAGCCGGCCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-4659a directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4659a miRNA Mature ID miR-4659a-3p

miRNA Sequence

UUUCUUCUUAGACAUGGCAACG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

miR-4659b directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4659b miRNA Mature ID miR-4659b-3p

miRNA Sequence

UUUCUUCUUAGACAUGGCAGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

miR-4661 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4661 miRNA Mature ID miR-4661-3p

miRNA Sequence

CAGGAUCCACAGAGCUAGUCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-4695 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4695 miRNA Mature ID miR-4695-3p

miRNA Sequence

UGAUCUCACCGCUGCCUCCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-4722 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-4755 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4755 miRNA Mature ID miR-4755-3p

miRNA Sequence

AGCCAGGCUCUGAAGGGAAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-4772 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4772 miRNA Mature ID miR-4772-3p

miRNA Sequence

CCUGCAACUUUGCCUGAUCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-4775 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4775 miRNA Mature ID miR-4775

miRNA Sequence

UUAAUUUUUUGUUUCGGUCACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon45

miR-4778 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4778 miRNA Mature ID miR-4778-3p

miRNA Sequence

UCUUCUUCCUUUGCAGAGUUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

miR-488 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-488 miRNA Mature ID miR-488-5p

miRNA Sequence

CCCAGAUAAUGGCACUCUCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon47

miR-500a directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-500a miRNA Mature ID miR-500a-5p

miRNA Sequence

UAAUCCUUGCUACCUGGGUGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-501 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-501 miRNA Mature ID miR-501-5p

miRNA Sequence

AAUCCUUUGUCCCUGGGUGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon49

miR-5010 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5010 miRNA Mature ID miR-5010-3p

miRNA Sequence

UUUUGUGUCUCCCAUUCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-504 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-504 miRNA Mature ID miR-504-3p

miRNA Sequence

GGGAGUGCAGGGCAGGGUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-5197 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5197 miRNA Mature ID miR-5197-5p

miRNA Sequence

CAAUGGCACAAACUCAUUCUUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-519d directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-519d miRNA Mature ID miR-519d-5p

miRNA Sequence

CCUCCAAAGGGAAGCGCUUUCUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon53

miR-548aa directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548aa miRNA Mature ID miR-548aa

miRNA Sequence

AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon54

miR-548ap directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548ap miRNA Mature ID miR-548ap-3p

miRNA Sequence

AAAAACCACAAUUACUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon55

miR-548as directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548as miRNA Mature ID miR-548as-3p

miRNA Sequence

UAAAACCCACAAUUAUGUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-548at directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548at miRNA Mature ID miR-548at-3p

miRNA Sequence

CAAAACCGCAGUAACUUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-548ay directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548ay miRNA Mature ID miR-548ay-3p

miRNA Sequence

CAAAACCGCGAUUACUCUUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon58

miR-548t directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548t miRNA Mature ID miR-548t-3p

miRNA Sequence

AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-551b directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-551b miRNA Mature ID miR-551b-5p

miRNA Sequence

GAAAUCAAGCGUGGGUGAGACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon60

miR-564 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-564 miRNA Mature ID miR-564

miRNA Sequence

AGGCACGGUGUCAGCAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-605 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-605 miRNA Mature ID miR-605-5p

miRNA Sequence

UAAAUCCCAUGGUGCCUUCUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon62

miR-616 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon63

miR-6727 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

UCCUGCCACCUCCUCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon64

miR-6736 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6736 miRNA Mature ID miR-6736-3p

miRNA Sequence

UCAGCUCCUCUCUACCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon65

miR-6747 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon66

miR-6787 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6787 miRNA Mature ID miR-6787-3p

miRNA Sequence

UCUCAGCUGCUGCCCUCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon67

miR-6835 directly targets SLC38A9 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6835 miRNA Mature ID miR-6835-3p

miRNA Sequence

AAAAGCACUUUUCUGUCUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon68

miR-6875 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6875 miRNA Mature ID miR-6875-3p

miRNA Sequence

AUUCUUCCUGCCCUGGCUCCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon69

miR-6890 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

CCACUGCCUAUGCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon70

miR-764 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-764 miRNA Mature ID miR-764

miRNA Sequence

GCAGGUGCUCACUUGUCCUCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon71

miR-8063 directly targets SLC38A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8063 miRNA Mature ID miR-8063

miRNA Sequence

UCAAAAUCAGGAGUCGGGGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon72

miR-8086 directly targets SLC38A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8086 miRNA Mature ID miR-8086

miRNA Sequence

UGCUAGUCUGGACUGAUAUGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
14 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
17 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.