Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0336 Transporter Info
Gene Name	SLC38A9
Transporter Name	Sodium-coupled neutral amino acid transporter 9
Gene ID	153129
UniProt ID	Q8NBW4

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg04401436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.15E-08; Z-score:-1.37E+00
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg05146599)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.86E+00	Statistic Test	p-value:4.49E-08; Z-score:-2.11E+00
Methylation in Case	1.31E-01 (Median)	Methylation in Control	2.43E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg13598790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:5.80E-07; Z-score:1.11E+00
Methylation in Case	9.41E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg18034294)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.48E+00	Statistic Test	p-value:2.21E-06; Z-score:-1.28E+00
Methylation in Case	5.29E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg05462905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.48E-03; Z-score:-6.64E-01
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg07042489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.30E-03; Z-score:-7.56E-01
Methylation in Case	8.63E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg07262873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.73E-03; Z-score:-5.05E-01
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg13589588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:3.72E-02; Z-score:3.98E-01
Methylation in Case	8.99E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg05146599)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:1.47E-04; Z-score:-5.62E+00
Methylation in Case	7.38E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg13598790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:1.75E-02; Z-score:-1.07E+00
Methylation in Case	3.81E-02 (Median)	Methylation in Control	4.36E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg18034294)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.35E-02; Z-score:-1.23E+00
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	TSS1500 (cg11493924)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:5.09E-04; Z-score:-2.71E+00
Methylation in Case	5.86E-02 (Median)	Methylation in Control	7.24E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	TSS1500 (cg11466815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:3.93E-02; Z-score:-1.09E+00
Methylation in Case	1.83E-02 (Median)	Methylation in Control	2.21E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	TSS200 (cg10968375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:2.42E-02; Z-score:-1.20E+00
Methylation in Case	2.01E-02 (Median)	Methylation in Control	2.89E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	Body (cg07042489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.45E-03; Z-score:-3.55E+00
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	Body (cg05462905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:2.27E-03; Z-score:-2.88E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	7.50E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	Body (cg24749564)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.29E-03; Z-score:2.20E+00
Methylation in Case	8.16E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	Body (cg27622900)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:7.90E-03; Z-score:-1.89E+00
Methylation in Case	7.82E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC38A9 in bladder cancer			[ 2 ]
Location	Body (cg26540004)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:2.27E-02; Z-score:9.31E-01
Methylation in Case	4.28E-01 (Median)	Methylation in Control	3.84E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	5'UTR (cg05146599)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:8.04E-05; Z-score:1.55E+00
Methylation in Case	8.30E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	5'UTR (cg18034294)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.23E-03; Z-score:-4.28E-01
Methylation in Case	8.81E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	5'UTR (cg13598790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:4.07E-02; Z-score:-4.33E-01
Methylation in Case	2.77E-02 (Median)	Methylation in Control	3.10E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	TSS1500 (cg11493924)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:8.90E-03; Z-score:-3.30E-01
Methylation in Case	5.87E-02 (Median)	Methylation in Control	6.68E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	TSS1500 (cg09277365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:4.36E-02; Z-score:-5.28E-01
Methylation in Case	4.80E-02 (Median)	Methylation in Control	5.58E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	TSS200 (cg10968375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.41E+00	Statistic Test	p-value:3.13E-02; Z-score:-5.84E-01
Methylation in Case	9.94E-03 (Median)	Methylation in Control	1.40E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	TSS200 (cg12824106)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:3.20E-02; Z-score:-3.71E-01
Methylation in Case	5.80E-03 (Median)	Methylation in Control	7.47E-03 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	Body (cg07262873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.78E+00	Statistic Test	p-value:1.47E-18; Z-score:3.24E+00
Methylation in Case	4.35E-01 (Median)	Methylation in Control	2.44E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	Body (cg07042489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.60E-04; Z-score:-7.83E-01
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	Body (cg26540004)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:2.58E-03; Z-score:9.00E-01
Methylation in Case	4.77E-01 (Median)	Methylation in Control	4.12E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	Body (cg13589588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:6.19E-03; Z-score:-6.61E-01
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	Body (cg27622900)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:8.53E-03; Z-score:-7.33E-01
Methylation in Case	7.71E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC38A9 in breast cancer			[ 3 ]
Location	Body (cg24749564)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.76E-02; Z-score:4.40E-01
Methylation in Case	7.99E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg04401436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.68E-02; Z-score:3.05E-01
Methylation in Case	2.71E-02 (Median)	Methylation in Control	2.54E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg11466815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:9.07E-03; Z-score:5.38E-01
Methylation in Case	2.52E-02 (Median)	Methylation in Control	2.40E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg11283154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:8.79E-03; Z-score:6.50E-01
Methylation in Case	2.36E-02 (Median)	Methylation in Control	2.23E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg07397574)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.53E-02; Z-score:2.82E-01
Methylation in Case	1.72E-02 (Median)	Methylation in Control	1.67E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg12824106)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:2.68E-02; Z-score:1.93E-01
Methylation in Case	1.09E-02 (Median)	Methylation in Control	1.07E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg09554558)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:4.08E-02; Z-score:3.25E-01
Methylation in Case	1.36E-02 (Median)	Methylation in Control	1.30E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg10968375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.09E-02; Z-score:5.38E-01
Methylation in Case	1.32E-02 (Median)	Methylation in Control	1.23E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in colorectal cancer			[ 5 ]
Location	5'UTR (cg13598790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:2.64E-03; Z-score:6.53E-01
Methylation in Case	2.01E-02 (Median)	Methylation in Control	1.77E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in colorectal cancer			[ 5 ]
Location	TSS200 (cg10968375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:2.45E-03; Z-score:5.68E-01
Methylation in Case	1.10E-02 (Median)	Methylation in Control	9.34E-03 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in colorectal cancer			[ 5 ]
Location	TSS200 (cg09200496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:3.94E-02; Z-score:-5.35E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in colorectal cancer			[ 5 ]
Location	Body (cg27622900)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.29E-06; Z-score:-1.59E+00
Methylation in Case	8.49E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in colorectal cancer			[ 5 ]
Location	Body (cg07262873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:1.30E-05; Z-score:1.36E+00
Methylation in Case	6.52E-01 (Median)	Methylation in Control	5.40E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg05146599)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.00E-05; Z-score:-1.17E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg26540004)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.42E+00	Statistic Test	p-value:4.51E-08; Z-score:-1.36E+00
Methylation in Case	2.59E-01 (Median)	Methylation in Control	3.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg07042489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:4.51E-08; Z-score:-1.35E+00
Methylation in Case	7.51E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg07262873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.46E+00	Statistic Test	p-value:4.44E-07; Z-score:-1.44E+00
Methylation in Case	2.37E-01 (Median)	Methylation in Control	3.46E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg24749564)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.05E-03; Z-score:-4.70E-01
Methylation in Case	8.04E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in HIV infection			[ 7 ]
Location	5'UTR (cg18034294)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.33E-02; Z-score:7.86E-01
Methylation in Case	9.52E-01 (Median)	Methylation in Control	9.26E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in HIV infection			[ 7 ]
Location	TSS1500 (cg11493924)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.34E-02; Z-score:5.97E-01
Methylation in Case	6.95E-02 (Median)	Methylation in Control	6.16E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in HIV infection			[ 7 ]
Location	TSS1500 (cg03329536)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.50E-02; Z-score:-3.25E-01
Methylation in Case	5.34E-02 (Median)	Methylation in Control	5.71E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in HIV infection			[ 7 ]
Location	TSS200 (cg12824106)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.56E+00	Statistic Test	p-value:6.35E-03; Z-score:7.59E-01
Methylation in Case	7.25E-03 (Median)	Methylation in Control	4.66E-03 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in HIV infection			[ 7 ]
Location	TSS200 (cg11283154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.48E+00	Statistic Test	p-value:3.35E-02; Z-score:7.00E-01
Methylation in Case	1.38E-02 (Median)	Methylation in Control	9.37E-03 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A9 in HIV infection			[ 7 ]
Location	Body (cg26540004)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:3.40E-06; Z-score:1.94E+00
Methylation in Case	7.94E-01 (Median)	Methylation in Control	6.77E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A9 in HIV infection			[ 7 ]
Location	Body (cg27622900)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.08E-03; Z-score:6.29E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A9 in HIV infection			[ 7 ]
Location	Body (cg07262873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.24E-02; Z-score:3.12E-01
Methylation in Case	7.81E-01 (Median)	Methylation in Control	7.67E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	5'UTR (cg21660392)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.11E-03; Z-score:-7.19E-01
Methylation in Case	7.54E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	5'UTR (cg08240652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:1.67E-03; Z-score:1.19E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	5'UTR (cg12484332)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.95E-02; Z-score:-1.51E-01
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS1500 (cg13161658)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.02E+00	Statistic Test	p-value:1.38E-05; Z-score:1.43E+00
Methylation in Case	3.23E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS1500 (cg18584905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:1.89E-02; Z-score:-1.22E+00
Methylation in Case	1.75E-01 (Median)	Methylation in Control	2.21E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS1500 (cg03483626)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:2.09E-02; Z-score:3.87E-01
Methylation in Case	5.28E-01 (Median)	Methylation in Control	5.06E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg22364668)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.71E-07; Z-score:2.89E-01
Methylation in Case	4.90E-02 (Median)	Methylation in Control	4.57E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg17344085)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:1.33E-02; Z-score:-5.96E-01
Methylation in Case	3.03E-02 (Median)	Methylation in Control	3.37E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg03067613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:8.57E-05; Z-score:1.25E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg15531450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:3.16E-04; Z-score:9.13E-01
Methylation in Case	5.40E-01 (Median)	Methylation in Control	4.75E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg02793733)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.77E-03; Z-score:-2.91E-01
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg19503341)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.09E-02; Z-score:7.48E-01
Methylation in Case	4.87E-01 (Median)	Methylation in Control	4.56E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC38A9 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg17461670)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.32E-02; Z-score:-3.69E-01
Methylation in Case	8.63E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in systemic lupus erythematosus			[ 9 ]
Location	5'UTR (cg04401436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.77E-02; Z-score:-7.40E-02
Methylation in Case	9.11E-02 (Median)	Methylation in Control	9.25E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in systemic lupus erythematosus			[ 9 ]
Location	TSS1500 (cg09277365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.38E-02; Z-score:-1.09E-01
Methylation in Case	7.65E-02 (Median)	Methylation in Control	7.87E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in systemic lupus erythematosus			[ 9 ]
Location	TSS200 (cg21173440)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.44E-02; Z-score:5.96E-02
Methylation in Case	1.86E-01 (Median)	Methylation in Control	1.85E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in systemic lupus erythematosus			[ 9 ]
Location	Body (cg27622900)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:8.30E-03; Z-score:-2.90E-01
Methylation in Case	8.57E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in colon adenocarcinoma			[ 10 ]
Location	TSS1500 (cg11826452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.30E-03; Z-score:-8.62E-01
Methylation in Case	4.82E-01 (Median)	Methylation in Control	5.09E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in colon adenocarcinoma			[ 10 ]
Location	TSS1500 (cg14282904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.46E+00	Statistic Test	p-value:1.36E-03; Z-score:1.95E+00
Methylation in Case	1.95E-01 (Median)	Methylation in Control	7.92E-02 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in colon adenocarcinoma			[ 10 ]
Location	1stExon (cg16163981)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:3.89E-03; Z-score:1.12E+00
Methylation in Case	4.27E-01 (Median)	Methylation in Control	3.78E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in colon adenocarcinoma			[ 10 ]
Location	3'UTR (cg03954999)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:2.26E-03; Z-score:-2.94E+00
Methylation in Case	7.32E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg11493924)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:7.53E-08; Z-score:-8.60E-01
Methylation in Case	6.67E-02 (Median)	Methylation in Control	8.28E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg09277365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:2.12E-03; Z-score:-4.30E-01
Methylation in Case	5.72E-02 (Median)	Methylation in Control	6.31E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg03329536)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:2.74E-02; Z-score:-6.27E-01
Methylation in Case	5.71E-02 (Median)	Methylation in Control	6.24E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg10968375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:3.43E-05; Z-score:-6.86E-01
Methylation in Case	4.54E-02 (Median)	Methylation in Control	5.02E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg09554558)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:3.51E-03; Z-score:-6.57E-01
Methylation in Case	4.70E-02 (Median)	Methylation in Control	5.10E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	Body (cg26540004)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:1.78E-20; Z-score:-4.54E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	Body (cg24749564)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.06E-07; Z-score:-1.27E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	Body (cg05462905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.73E-03; Z-score:-5.69E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC38A9 in papillary thyroid cancer			[ 11 ]
Location	Body (cg07262873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:3.72E-02; Z-score:3.77E-01
Methylation in Case	4.02E-01 (Median)	Methylation in Control	3.79E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in prostate cancer			[ 12 ]
Location	TSS200 (cg07920064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:1.44E-03; Z-score:3.39E+00
Methylation in Case	4.96E-02 (Median)	Methylation in Control	3.51E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A9 in prostate cancer			[ 12 ]
Location	Body (cg00502885)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:6.64E-04; Z-score:5.27E+00
Methylation in Case	9.14E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A9 in prostate cancer			[ 12 ]
Location	Body (cg10062193)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.92E+00	Statistic Test	p-value:7.22E-04; Z-score:5.15E+00
Methylation in Case	7.96E-01 (Median)	Methylation in Control	2.72E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A9 in prostate cancer			[ 12 ]
Location	3'UTR (cg03825810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.64E+00	Statistic Test	p-value:5.06E-03; Z-score:-6.52E+00
Methylation in Case	5.14E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in lung adenocarcinoma			[ 13 ]
Location	Body (cg07262873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:1.10E-03; Z-score:2.95E+00
Methylation in Case	6.01E-01 (Median)	Methylation in Control	4.56E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A9 in panic disorder			[ 14 ]
Location	Body (cg05462905)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:7.29E-03; Z-score:-2.28E-01
Methylation in Case	5.42E-01 (Median)	Methylation in Control	6.35E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	72 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-106a directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106a	miRNA Mature ID	miR-106a-3p
miRNA Sequence	CUGCAAUGUAAGCACUUCUUAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-122 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-122	miRNA Mature ID	miR-122-5p
miRNA Sequence	UGGAGUGUGACAAUGGUGUUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-125a directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-125a	miRNA Mature ID	miR-125a-3p
miRNA Sequence	ACAGGUGAGGUUCUUGGGAGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon4	miR-1264 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1264	miRNA Mature ID	miR-1264
miRNA Sequence	CAAGUCUUAUUUGAGCACCUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-129 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-1304 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-3p
miRNA Sequence	UCUCACUGUAGCCUCGAACCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-130a directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-130a	miRNA Mature ID	miR-130a-3p
miRNA Sequence	CAGUGCAAUGUUAAAAGGGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-130b directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-130b	miRNA Mature ID	miR-130b-3p
miRNA Sequence	CAGUGCAAUGAUGAAAGGGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-145 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-145	miRNA Mature ID	miR-145-3p
miRNA Sequence	GGAUUCCUGGAAAUACUGUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-183 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-183	miRNA Mature ID	miR-183-5p
miRNA Sequence	UAUGGCACUGGUAGAAUUCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-1911 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1911	miRNA Mature ID	miR-1911-5p
miRNA Sequence	UGAGUACCGCCAUGUCUGUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-1972 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1972	miRNA Mature ID	miR-1972
miRNA Sequence	UCAGGCCAGGCACAGUGGCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-1976 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1976	miRNA Mature ID	miR-1976
miRNA Sequence	CCUCCUGCCCUCCUUGCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-2113 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2113	miRNA Mature ID	miR-2113
miRNA Sequence	AUUUGUGCUUGGCUCUGUCAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-24-1 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-24-1	miRNA Mature ID	miR-24-1-5p
miRNA Sequence	UGCCUACUGAGCUGAUAUCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-24-2 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-24-2	miRNA Mature ID	miR-24-2-5p
miRNA Sequence	UGCCUACUGAGCUGAAACACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-301a directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-301a	miRNA Mature ID	miR-301a-3p
miRNA Sequence	CAGUGCAAUAGUAUUGUCAAAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-301b directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-301b	miRNA Mature ID	miR-301b-3p
miRNA Sequence	CAGUGCAAUGAUAUUGUCAAAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-3135b directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3135b	miRNA Mature ID	miR-3135b
miRNA Sequence	GGCUGGAGCGAGUGCAGUGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-3194 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3194	miRNA Mature ID	miR-3194-5p
miRNA Sequence	GGCCAGCCACCAGGAGGGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-330 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-330	miRNA Mature ID	miR-330-3p
miRNA Sequence	GCAAAGCACACGGCCUGCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-3652 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3652	miRNA Mature ID	miR-3652
miRNA Sequence	CGGCUGGAGGUGUGAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-3654 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3654	miRNA Mature ID	miR-3654
miRNA Sequence	GACUGGACAAGCUGAGGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-3666 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3666	miRNA Mature ID	miR-3666
miRNA Sequence	CAGUGCAAGUGUAGAUGCCGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-3675 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3675	miRNA Mature ID	miR-3675-3p
miRNA Sequence	CAUCUCUAAGGAACUCCCCCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-371a directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-371a	miRNA Mature ID	miR-371a-5p
miRNA Sequence	ACUCAAACUGUGGGGGCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon27	miR-371b directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-371b	miRNA Mature ID	miR-371b-5p
miRNA Sequence	ACUCAAAAGAUGGCGGCACUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon28	miR-372 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-372	miRNA Mature ID	miR-372-5p
miRNA Sequence	CCUCAAAUGUGGAGCACUAUUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon29	miR-373 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-373	miRNA Mature ID	miR-373-5p
miRNA Sequence	ACUCAAAAUGGGGGCGCUUUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon30	miR-3934 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3934	miRNA Mature ID	miR-3934-5p
miRNA Sequence	UCAGGUGUGGAAACUGAGGCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon31	miR-4295 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4295	miRNA Mature ID	miR-4295
miRNA Sequence	CAGUGCAAUGUUUUCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-4430 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4430	miRNA Mature ID	miR-4430
miRNA Sequence	AGGCUGGAGUGAGCGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-4474 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4474	miRNA Mature ID	miR-4474-5p
miRNA Sequence	UUAGUCUCAUGAUCAGACACA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon34	miR-4520 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4520	miRNA Mature ID	miR-4520-3p
miRNA Sequence	UUGGACAGAAAACACGCAGGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-454 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-454	miRNA Mature ID	miR-454-3p
miRNA Sequence	UAGUGCAAUAUUGCUUAUAGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon36	miR-4638 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4638	miRNA Mature ID	miR-4638-3p
miRNA Sequence	CCUGGACACCGCUCAGCCGGCCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-4659a directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4659a	miRNA Mature ID	miR-4659a-3p
miRNA Sequence	UUUCUUCUUAGACAUGGCAACG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon38	miR-4659b directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4659b	miRNA Mature ID	miR-4659b-3p
miRNA Sequence	UUUCUUCUUAGACAUGGCAGCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon39	miR-4661 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4661	miRNA Mature ID	miR-4661-3p
miRNA Sequence	CAGGAUCCACAGAGCUAGUCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-4695 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4695	miRNA Mature ID	miR-4695-3p
miRNA Sequence	UGAUCUCACCGCUGCCUCCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon41	miR-4722 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-3p
miRNA Sequence	ACCUGCCAGCACCUCCCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-4755 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4755	miRNA Mature ID	miR-4755-3p
miRNA Sequence	AGCCAGGCUCUGAAGGGAAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-4772 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4772	miRNA Mature ID	miR-4772-3p
miRNA Sequence	CCUGCAACUUUGCCUGAUCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon44	miR-4775 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4775	miRNA Mature ID	miR-4775
miRNA Sequence	UUAAUUUUUUGUUUCGGUCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon45	miR-4778 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4778	miRNA Mature ID	miR-4778-3p
miRNA Sequence	UCUUCUUCCUUUGCAGAGUUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon46	miR-488 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-488	miRNA Mature ID	miR-488-5p
miRNA Sequence	CCCAGAUAAUGGCACUCUCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon47	miR-500a directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-500a	miRNA Mature ID	miR-500a-5p
miRNA Sequence	UAAUCCUUGCUACCUGGGUGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon48	miR-501 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-501	miRNA Mature ID	miR-501-5p
miRNA Sequence	AAUCCUUUGUCCCUGGGUGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon49	miR-5010 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5010	miRNA Mature ID	miR-5010-3p
miRNA Sequence	UUUUGUGUCUCCCAUUCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon50	miR-504 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-504	miRNA Mature ID	miR-504-3p
miRNA Sequence	GGGAGUGCAGGGCAGGGUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon51	miR-5197 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5197	miRNA Mature ID	miR-5197-5p
miRNA Sequence	CAAUGGCACAAACUCAUUCUUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon52	miR-519d directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-5p
miRNA Sequence	CCUCCAAAGGGAAGCGCUUUCUGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon53	miR-548aa directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548aa	miRNA Mature ID	miR-548aa
miRNA Sequence	AAAAACCACAAUUACUUUUGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon54	miR-548ap directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ap	miRNA Mature ID	miR-548ap-3p
miRNA Sequence	AAAAACCACAAUUACUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon55	miR-548as directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548as	miRNA Mature ID	miR-548as-3p
miRNA Sequence	UAAAACCCACAAUUAUGUUUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon56	miR-548at directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548at	miRNA Mature ID	miR-548at-3p
miRNA Sequence	CAAAACCGCAGUAACUUUUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon57	miR-548ay directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ay	miRNA Mature ID	miR-548ay-3p
miRNA Sequence	CAAAACCGCGAUUACUCUUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon58	miR-548t directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548t	miRNA Mature ID	miR-548t-3p
miRNA Sequence	AAAAACCACAAUUACUUUUGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon59	miR-551b directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-551b	miRNA Mature ID	miR-551b-5p
miRNA Sequence	GAAAUCAAGCGUGGGUGAGACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon60	miR-564 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-564	miRNA Mature ID	miR-564
miRNA Sequence	AGGCACGGUGUCAGCAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon61	miR-605 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-605	miRNA Mature ID	miR-605-5p
miRNA Sequence	UAAAUCCCAUGGUGCCUUCUCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon62	miR-616 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-616	miRNA Mature ID	miR-616-5p
miRNA Sequence	ACUCAAAACCCUUCAGUGACUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon63	miR-6727 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6727	miRNA Mature ID	miR-6727-3p
miRNA Sequence	UCCUGCCACCUCCUCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon64	miR-6736 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6736	miRNA Mature ID	miR-6736-3p
miRNA Sequence	UCAGCUCCUCUCUACCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon65	miR-6747 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6747	miRNA Mature ID	miR-6747-3p
miRNA Sequence	UCCUGCCUUCCUCUGCACCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon66	miR-6787 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6787	miRNA Mature ID	miR-6787-3p
miRNA Sequence	UCUCAGCUGCUGCCCUCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon67	miR-6835 directly targets SLC38A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6835	miRNA Mature ID	miR-6835-3p
miRNA Sequence	AAAAGCACUUUUCUGUCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon68	miR-6875 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6875	miRNA Mature ID	miR-6875-3p
miRNA Sequence	AUUCUUCCUGCCCUGGCUCCAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon69	miR-6890 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6890	miRNA Mature ID	miR-6890-3p
miRNA Sequence	CCACUGCCUAUGCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon70	miR-764 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-764	miRNA Mature ID	miR-764
miRNA Sequence	GCAGGUGCUCACUUGUCCUCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon71	miR-8063 directly targets SLC38A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8063	miRNA Mature ID	miR-8063
miRNA Sequence	UCAAAAUCAGGAGUCGGGGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon72	miR-8086 directly targets SLC38A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8086	miRNA Mature ID	miR-8086
miRNA Sequence	UGCUAGUCUGGACUGAUAUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
14	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
17	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence