Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0334 Transporter Info
Gene Name	SLC38A7
Transporter Name	Putative sodium-coupled neutral amino acid transporter 7
Gene ID	55238
UniProt ID	Q9NVC3

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg05006947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:4.11E-08; Z-score:1.24E+00
Methylation in Case	9.13E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg05830473)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:4.82E-08; Z-score:1.56E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	6.66E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg06250214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.38E+00	Statistic Test	p-value:5.76E-08; Z-score:-1.65E+00
Methylation in Case	1.20E-01 (Median)	Methylation in Control	2.87E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg06696917)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:6.76E-08; Z-score:-1.28E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg08855361)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:1.55E-07; Z-score:-1.46E+00
Methylation in Case	7.32E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg11933375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:3.41E-07; Z-score:1.23E+00
Methylation in Case	9.31E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg26758340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.25E-05; Z-score:-7.33E-01
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg05876883)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.74E-03; Z-score:6.52E-01
Methylation in Case	9.22E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC38A7 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg27182807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:3.36E-09; Z-score:-1.71E+00
Methylation in Case	7.80E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in bladder cancer			[ 2 ]
Location	5'UTR (cg06250214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.66E-05; Z-score:-1.85E+01
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in bladder cancer			[ 2 ]
Location	5'UTR (cg11933375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:4.41E-05; Z-score:-1.14E+01
Methylation in Case	5.11E-02 (Median)	Methylation in Control	6.21E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in bladder cancer			[ 2 ]
Location	TSS1500 (cg07424912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:4.43E-03; Z-score:5.63E+00
Methylation in Case	7.21E-01 (Median)	Methylation in Control	5.64E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in bladder cancer			[ 2 ]
Location	3'UTR (cg27182807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.59E-04; Z-score:-4.43E+00
Methylation in Case	7.70E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in breast cancer			[ 3 ]
Location	5'UTR (cg06250214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.20E-07; Z-score:-1.70E+00
Methylation in Case	8.56E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in breast cancer			[ 3 ]
Location	TSS1500 (cg06073139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.79E+00	Statistic Test	p-value:3.19E-12; Z-score:2.71E+00
Methylation in Case	4.53E-01 (Median)	Methylation in Control	2.53E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in breast cancer			[ 3 ]
Location	TSS1500 (cg04229059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.39E+00	Statistic Test	p-value:1.58E-06; Z-score:1.59E+00
Methylation in Case	2.11E-01 (Median)	Methylation in Control	1.52E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in breast cancer			[ 3 ]
Location	TSS1500 (cg07424912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:6.70E-03; Z-score:7.85E-01
Methylation in Case	4.54E-01 (Median)	Methylation in Control	3.96E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A7 in breast cancer			[ 3 ]
Location	TSS200 (cg06320982)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.69E-02; Z-score:1.19E-01
Methylation in Case	8.20E-02 (Median)	Methylation in Control	7.93E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg08855361)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.02E-04; Z-score:7.52E-01
Methylation in Case	5.27E-02 (Median)	Methylation in Control	4.66E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg11933375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.30E-03; Z-score:8.54E-01
Methylation in Case	2.16E-02 (Median)	Methylation in Control	1.86E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg26758340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.76E-03; Z-score:3.06E+00
Methylation in Case	9.38E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg06696917)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.70E-02; Z-score:5.19E-01
Methylation in Case	3.18E-02 (Median)	Methylation in Control	2.97E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A7 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg04229059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:1.30E-04; Z-score:1.14E+00
Methylation in Case	2.23E-01 (Median)	Methylation in Control	1.67E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A7 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg06320982)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.48E+00	Statistic Test	p-value:2.43E-04; Z-score:1.01E+00
Methylation in Case	4.30E-02 (Median)	Methylation in Control	2.91E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in colon adenocarcinoma			[ 5 ]
Location	5'UTR (cg17537007)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.48E-04; Z-score:-1.83E+00
Methylation in Case	7.82E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in colon adenocarcinoma			[ 5 ]
Location	Body (cg04491808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:3.11E-05; Z-score:-2.29E+00
Methylation in Case	5.16E-01 (Median)	Methylation in Control	6.32E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in colon adenocarcinoma			[ 5 ]
Location	Body (cg13939166)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:3.94E-05; Z-score:-2.48E+00
Methylation in Case	6.27E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in colon adenocarcinoma			[ 5 ]
Location	Body (cg23387310)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:6.41E-05; Z-score:-3.67E+00
Methylation in Case	5.96E-01 (Median)	Methylation in Control	6.74E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A7 in colon adenocarcinoma			[ 5 ]
Location	Body (cg21557445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.47E-04; Z-score:-1.09E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.42E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A7 in colon adenocarcinoma			[ 5 ]
Location	Body (cg10369665)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.47E-03; Z-score:2.00E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	5.69E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in colorectal cancer			[ 6 ]
Location	5'UTR (cg08855361)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:2.75E-05; Z-score:1.25E+00
Methylation in Case	4.39E-02 (Median)	Methylation in Control	3.42E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in colorectal cancer			[ 6 ]
Location	5'UTR (cg06250214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.10E-03; Z-score:-7.87E-01
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in colorectal cancer			[ 6 ]
Location	5'UTR (cg05006947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:5.04E-03; Z-score:-4.41E-01
Methylation in Case	5.49E-02 (Median)	Methylation in Control	6.62E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in colorectal cancer			[ 6 ]
Location	5'UTR (cg26758340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:6.94E-03; Z-score:-1.86E-01
Methylation in Case	9.22E-01 (Median)	Methylation in Control	9.25E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A7 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg07424912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:5.66E-03; Z-score:-1.01E+00
Methylation in Case	5.33E-01 (Median)	Methylation in Control	6.21E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A7 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg04229059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:1.10E-02; Z-score:6.02E-01
Methylation in Case	3.21E-01 (Median)	Methylation in Control	2.86E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A7 in colorectal cancer			[ 6 ]
Location	3'UTR (cg27182807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.74E-04; Z-score:-9.53E-01
Methylation in Case	8.97E-01 (Median)	Methylation in Control	9.09E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg26758340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:5.90E-03; Z-score:8.71E-02
Methylation in Case	7.76E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg21384789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:5.25E-11; Z-score:-8.80E+00
Methylation in Case	6.49E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg06073139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.64E-05; Z-score:-1.04E+00
Methylation in Case	3.71E-01 (Median)	Methylation in Control	4.54E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg07424912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:3.72E-04; Z-score:-1.11E+00
Methylation in Case	3.35E-01 (Median)	Methylation in Control	4.17E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A7 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg04229059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:9.64E-03; Z-score:-8.43E-01
Methylation in Case	1.83E-01 (Median)	Methylation in Control	2.04E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A7 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg06320982)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:1.19E-02; Z-score:-5.86E-01
Methylation in Case	7.54E-02 (Median)	Methylation in Control	8.89E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A7 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg22414192)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.55E+00	Statistic Test	p-value:7.49E-14; Z-score:-9.03E+00
Methylation in Case	6.08E-01 (Median)	Methylation in Control	9.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in HIV infection			[ 8 ]
Location	5'UTR (cg11933375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:7.19E-03; Z-score:9.54E-01
Methylation in Case	7.40E-02 (Median)	Methylation in Control	5.96E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in HIV infection			[ 8 ]
Location	5'UTR (cg08855361)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:2.07E-02; Z-score:8.63E-01
Methylation in Case	1.47E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in HIV infection			[ 8 ]
Location	5'UTR (cg05006947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:4.46E-02; Z-score:7.29E-01
Methylation in Case	1.29E-01 (Median)	Methylation in Control	1.10E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in HIV infection			[ 8 ]
Location	TSS1500 (cg07424912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.98E-02; Z-score:4.51E-01
Methylation in Case	9.45E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A7 in HIV infection			[ 8 ]
Location	TSS200 (cg06320982)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:1.49E-06; Z-score:1.94E+00
Methylation in Case	1.69E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg05830473)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:3.42E-02; Z-score:-1.63E+00
Methylation in Case	1.35E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg06073139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.54E-02; Z-score:2.08E+00
Methylation in Case	6.29E-01 (Median)	Methylation in Control	5.42E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in papillary thyroid cancer			[ 10 ]
Location	5'UTR (cg11933375)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:7.71E-03; Z-score:-8.13E-01
Methylation in Case	5.81E-02 (Median)	Methylation in Control	6.51E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in papillary thyroid cancer			[ 10 ]
Location	TSS1500 (cg06073139)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.77E-02; Z-score:8.00E-01
Methylation in Case	4.56E-01 (Median)	Methylation in Control	4.03E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in papillary thyroid cancer			[ 10 ]
Location	TSS200 (cg06320982)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:8.39E-04; Z-score:6.86E-01
Methylation in Case	5.79E-02 (Median)	Methylation in Control	5.14E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in papillary thyroid cancer			[ 10 ]
Location	3'UTR (cg27182807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.26E-03; Z-score:-8.34E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in systemic lupus erythematosus			[ 11 ]
Location	5'UTR (cg08855361)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.69E-02; Z-score:9.69E-02
Methylation in Case	9.14E-02 (Median)	Methylation in Control	8.89E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in systemic lupus erythematosus			[ 11 ]
Location	5'UTR (cg05006947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:3.88E-02; Z-score:1.79E-01
Methylation in Case	5.81E-02 (Median)	Methylation in Control	5.49E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in systemic lupus erythematosus			[ 11 ]
Location	TSS1500 (cg04229059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.40E-02; Z-score:-2.03E-01
Methylation in Case	4.52E-01 (Median)	Methylation in Control	4.70E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in depression			[ 12 ]
Location	TSS1500 (cg07424912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:4.27E-02; Z-score:-1.34E-01
Methylation in Case	8.79E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in pancretic ductal adenocarcinoma			[ 13 ]
Location	TSS1500 (cg03556497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.18E+00	Statistic Test	p-value:2.21E-25; Z-score:3.99E+00
Methylation in Case	3.27E-01 (Median)	Methylation in Control	1.50E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A7 in pancretic ductal adenocarcinoma			[ 13 ]
Location	TSS1500 (cg07992308)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.24E-03; Z-score:-4.44E-01
Methylation in Case	5.31E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A7 in pancretic ductal adenocarcinoma			[ 13 ]
Location	Body (cg10156714)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.82E-13; Z-score:-1.80E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A7 in pancretic ductal adenocarcinoma			[ 13 ]
Location	Body (cg15192909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.03E-02; Z-score:-3.22E-01
Methylation in Case	4.85E-01 (Median)	Methylation in Control	4.96E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in panic disorder			[ 14 ]
Location	TSS1500 (cg07424912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.69E-02; Z-score:2.54E-01
Methylation in Case	3.94E+00 (Median)	Methylation in Control	3.83E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A7 in prostate cancer			[ 15 ]
Location	Body (cg14518227)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.83E+00	Statistic Test	p-value:1.54E-02; Z-score:-3.46E+00
Methylation in Case	4.39E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	108 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	let-7a directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7a	miRNA Mature ID	let-7a-5p
miRNA Sequence	UGAGGUAGUAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon2	let-7b directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7b	miRNA Mature ID	let-7b-5p
miRNA Sequence	UGAGGUAGUAGGUUGUGUGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon3	let-7c directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7c	miRNA Mature ID	let-7c-5p
miRNA Sequence	UGAGGUAGUAGGUUGUAUGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon4	let-7d directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7d	miRNA Mature ID	let-7d-5p
miRNA Sequence	AGAGGUAGUAGGUUGCAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon5	let-7e directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7e	miRNA Mature ID	let-7e-5p
miRNA Sequence	UGAGGUAGGAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon6	let-7f directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7f	miRNA Mature ID	let-7f-5p
miRNA Sequence	UGAGGUAGUAGAUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon7	let-7g directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7g	miRNA Mature ID	let-7g-5p
miRNA Sequence	UGAGGUAGUAGUUUGUACAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon8	let-7i directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	let-7i	miRNA Mature ID	let-7i-5p
miRNA Sequence	UGAGGUAGUAGUUUGUGCUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon9	miR-1271 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1271	miRNA Mature ID	miR-1271-3p
miRNA Sequence	AGUGCCUGCUAUGUGCCAGGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-1273h directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1273h	miRNA Mature ID	miR-1273h-5p
miRNA Sequence	CUGGGAGGUCAAGGCUGCAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon11	miR-141 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-141	miRNA Mature ID	miR-141-5p
miRNA Sequence	CAUCUUCCAGUACAGUGUUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-149 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-149	miRNA Mature ID	miR-149-3p
miRNA Sequence	AGGGAGGGACGGGGGCUGUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon13	miR-193b directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-193b	miRNA Mature ID	miR-193b-5p
miRNA Sequence	CGGGGUUUUGAGGGCGAGAUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon14	miR-19a directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-19a	miRNA Mature ID	miR-19a-5p
miRNA Sequence	AGUUUUGCAUAGUUGCACUACA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon15	miR-19b-1 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-19b-1	miRNA Mature ID	miR-19b-1-5p
miRNA Sequence	AGUUUUGCAGGUUUGCAUCCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon16	miR-19b-2 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-19b-2	miRNA Mature ID	miR-19b-2-5p
miRNA Sequence	AGUUUUGCAGGUUUGCAUUUCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon17	miR-202 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-202	miRNA Mature ID	miR-202-3p
miRNA Sequence	AGAGGUAUAGGGCAUGGGAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon18	miR-204 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-204	miRNA Mature ID	miR-204-5p
miRNA Sequence	UUCCCUUUGUCAUCCUAUGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-211 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-211	miRNA Mature ID	miR-211-5p
miRNA Sequence	UUCCCUUUGUCAUCCUUCGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-214 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-214	miRNA Mature ID	miR-214-5p
miRNA Sequence	UGCCUGUCUACACUUGCUGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-29a directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-29a	miRNA Mature ID	miR-29a-5p
miRNA Sequence	ACUGAUUUCUUUUGGUGUUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-30a directly targets SLC38A7			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30a	miRNA Mature ID	miR-30a-5p
miRNA Sequence	UGUAAACAUCCUCGACUGGAAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-30b directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30b	miRNA Mature ID	miR-30b-3p
miRNA Sequence	CUGGGAGGUGGAUGUUUACUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon24	miR-30b directly targets SLC38A7			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30b	miRNA Mature ID	miR-30b-5p
miRNA Sequence	UGUAAACAUCCUACACUCAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-30c directly targets SLC38A7			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c	miRNA Mature ID	miR-30c-5p
miRNA Sequence	UGUAAACAUCCUACACUCUCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-30c-1 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c-1	miRNA Mature ID	miR-30c-1-3p
miRNA Sequence	CUGGGAGAGGGUUGUUUACUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon27	miR-30c-2 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30c-2	miRNA Mature ID	miR-30c-2-3p
miRNA Sequence	CUGGGAGAAGGCUGUUUACUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon28	miR-30d directly targets SLC38A7			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30d	miRNA Mature ID	miR-30d-5p
miRNA Sequence	UGUAAACAUCCCCGACUGGAAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-30e directly targets SLC38A7			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30e	miRNA Mature ID	miR-30e-5p
miRNA Sequence	UGUAAACAUCCUUGACUGGAAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-3122 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3122	miRNA Mature ID	miR-3122
miRNA Sequence	GUUGGGACAAGAGGACGGUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon31	miR-3170 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3170	miRNA Mature ID	miR-3170
miRNA Sequence	CUGGGGUUCUGAGACAGACAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon32	miR-3187 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3187	miRNA Mature ID	miR-3187-3p
miRNA Sequence	UUGGCCAUGGGGCUGCGCGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon33	miR-323a directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-323a	miRNA Mature ID	miR-323a-5p
miRNA Sequence	AGGUGGUCCGUGGCGCGUUCGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-3658 directly targets SLC38A7			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3658	miRNA Mature ID	miR-3658
miRNA Sequence	UUUAAGAAAACACCAUGGAGAU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon35	miR-3689a directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689a	miRNA Mature ID	miR-3689a-3p
miRNA Sequence	CUGGGAGGUGUGAUAUCGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon36	miR-3689b directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689b	miRNA Mature ID	miR-3689b-3p
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon37	miR-3689c directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3689c	miRNA Mature ID	miR-3689c
miRNA Sequence	CUGGGAGGUGUGAUAUUGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon38	miR-3913 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3913	miRNA Mature ID	miR-3913-5p
miRNA Sequence	UUUGGGACUGAUCUUGAUGUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon39	miR-3920 directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3920	miRNA Mature ID	miR-3920
miRNA Sequence	ACUGAUUAUCUUAACUCUCUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-3929 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3929	miRNA Mature ID	miR-3929
miRNA Sequence	GAGGCUGAUGUGAGUAGACCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon41	miR-411 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-411	miRNA Mature ID	miR-411-5p
miRNA Sequence	UAGUAGACCGUAUAGCGUACG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-4291 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4291	miRNA Mature ID	miR-4291
miRNA Sequence	UUCAGCAGGAACAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-4310 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4310	miRNA Mature ID	miR-4310
miRNA Sequence	GCAGCAUUCAUGUCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon44	miR-4423 directly targets SLC38A7			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4423	miRNA Mature ID	miR-4423-5p
miRNA Sequence	AGUUGCCUUUUUGUUCCCAUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon45	miR-4435 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4435	miRNA Mature ID	miR-4435
miRNA Sequence	AUGGCCAGAGCUCACACAGAGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon46	miR-4458 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4458	miRNA Mature ID	miR-4458
miRNA Sequence	AGAGGUAGGUGUGGAAGAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon47	miR-4477a directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4477a	miRNA Mature ID	miR-4477a
miRNA Sequence	CUAUUAAGGACAUUUGUGAUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon48	miR-4478 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4478	miRNA Mature ID	miR-4478
miRNA Sequence	GAGGCUGAGCUGAGGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon49	miR-4500 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4500	miRNA Mature ID	miR-4500
miRNA Sequence	UGAGGUAGUAGUUUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon50	miR-4524a directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4524a	miRNA Mature ID	miR-4524a-3p
miRNA Sequence	UGAGACAGGCUUAUGCUGCUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon51	miR-4524b directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4524b	miRNA Mature ID	miR-4524b-3p
miRNA Sequence	GAGACAGGUUCAUGCUGCUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon52	miR-4639 directly targets SLC38A7			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4639	miRNA Mature ID	miR-4639-3p
miRNA Sequence	UCACUCUCACCUUGCUUUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon53	miR-4701 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4701	miRNA Mature ID	miR-4701-5p
miRNA Sequence	UUGGCCACCACACCUACCCCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon54	miR-4721 directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4721	miRNA Mature ID	miR-4721
miRNA Sequence	UGAGGGCUCCAGGUGACGGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon55	miR-4728 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4728	miRNA Mature ID	miR-4728-5p
miRNA Sequence	UGGGAGGGGAGAGGCAGCAAGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon56	miR-4755 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4755	miRNA Mature ID	miR-4755-5p
miRNA Sequence	UUUCCCUUCAGAGCCUGGCUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon57	miR-4755 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4755	miRNA Mature ID	miR-4755-3p
miRNA Sequence	AGCCAGGCUCUGAAGGGAAAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon58	miR-4781 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4781	miRNA Mature ID	miR-4781-3p
miRNA Sequence	AAUGUUGGAAUCCUCGCUAGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon59	miR-485 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-485	miRNA Mature ID	miR-485-5p
miRNA Sequence	AGAGGCUGGCCGUGAUGAAUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon60	miR-5002 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5002	miRNA Mature ID	miR-5002-5p
miRNA Sequence	AAUUUGGUUUCUGAGGCACUUAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon61	miR-5006 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5006	miRNA Mature ID	miR-5006-3p
miRNA Sequence	UUUCCCUUUCCAUCCUGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon62	miR-516a directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-516a	miRNA Mature ID	miR-516a-5p
miRNA Sequence	UUCUCGAGGAAAGAAGCACUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon63	miR-541 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-541	miRNA Mature ID	miR-541-3p
miRNA Sequence	UGGUGGGCACAGAAUCUGGACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon64	miR-548s directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548s	miRNA Mature ID	miR-548s
miRNA Sequence	AUGGCCAAAACUGCAGUUAUUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon65	miR-550a directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-550a	miRNA Mature ID	miR-550a-5p
miRNA Sequence	AGUGCCUGAGGGAGUAAGAGCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon66	miR-588 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-588	miRNA Mature ID	miR-588
miRNA Sequence	UUGGCCACAAUGGGUUAGAAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon67	miR-615 directly targets SLC38A7			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-615	miRNA Mature ID	miR-615-3p
miRNA Sequence	UCCGAGCCUGGGUCUCCCUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon68	miR-623 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-623	miRNA Mature ID	miR-623
miRNA Sequence	AUCCCUUGCAGGGGCUGUUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon69	miR-6501 directly targets SLC38A7			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6501	miRNA Mature ID	miR-6501-5p
miRNA Sequence	AGUUGCCAGGGCUGCCUUUGGU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon70	miR-6513 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6513	miRNA Mature ID	miR-6513-5p
miRNA Sequence	UUUGGGAUUGACGCCACAUGUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon71	miR-6514 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6514	miRNA Mature ID	miR-6514-3p
miRNA Sequence	CUGCCUGUUCUUCCACUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon72	miR-654 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-654	miRNA Mature ID	miR-654-5p
miRNA Sequence	UGGUGGGCCGCAGAACAUGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon73	miR-665 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon74	miR-6741 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6741	miRNA Mature ID	miR-6741-5p
miRNA Sequence	GUGGGUGCUGGUGGGAGCCGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon75	miR-6748 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6748	miRNA Mature ID	miR-6748-5p
miRNA Sequence	UGUGGGUGGGAAGGACUGGAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon76	miR-6769a directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6769a	miRNA Mature ID	miR-6769a-5p
miRNA Sequence	AGGUGGGUAUGGAGGAGCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon77	miR-6769b directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6769b	miRNA Mature ID	miR-6769b-5p
miRNA Sequence	UGGUGGGUGGGGAGGAGAAGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon78	miR-6779 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6779	miRNA Mature ID	miR-6779-5p
miRNA Sequence	CUGGGAGGGGCUGGGUUUGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon79	miR-6780a directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6780a	miRNA Mature ID	miR-6780a-5p
miRNA Sequence	UUGGGAGGGAAGACAGCUGGAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon80	miR-6785 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6785	miRNA Mature ID	miR-6785-5p
miRNA Sequence	UGGGAGGGCGUGGAUGAUGGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon81	miR-6788 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6788	miRNA Mature ID	miR-6788-5p
miRNA Sequence	CUGGGAGAAGAGUGGUGAAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon82	miR-6794 directly targets SLC38A7			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6794	miRNA Mature ID	miR-6794-3p
miRNA Sequence	CUCACUCUCAGUCCCUCCCU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon83	miR-6799 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6799	miRNA Mature ID	miR-6799-5p
miRNA Sequence	GGGGAGGUGUGCAGGGCUGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon84	miR-6811 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6811	miRNA Mature ID	miR-6811-3p
miRNA Sequence	AGCCUGUGCUUGUCCCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon85	miR-6823 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6823	miRNA Mature ID	miR-6823-5p
miRNA Sequence	UCAGGGUUGGUAGGGGUUGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon86	miR-6832 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6832	miRNA Mature ID	miR-6832-5p
miRNA Sequence	AGUAGAGAGGAAAAGUUAGGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon87	miR-6855 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6855	miRNA Mature ID	miR-6855-5p
miRNA Sequence	UUGGGGUUUGGGGUGCAGACAUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon88	miR-6880 directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6880	miRNA Mature ID	miR-6880-5p
miRNA Sequence	UGGUGGAGGAAGAGGGCAGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon89	miR-6883 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6883	miRNA Mature ID	miR-6883-5p
miRNA Sequence	AGGGAGGGUGUGGUAUGGAUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon90	miR-6884 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6884	miRNA Mature ID	miR-6884-5p
miRNA Sequence	AGAGGCUGAGAAGGUGAUGUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon91	miR-6888 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6888	miRNA Mature ID	miR-6888-5p
miRNA Sequence	AAGGAGAUGCUCAGGCAGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon92	miR-6890 directly targets SLC38A7			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6890	miRNA Mature ID	miR-6890-5p
miRNA Sequence	CAUGGGGUAGGGCAGAGUAGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon93	miR-6894 directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6894	miRNA Mature ID	miR-6894-5p
miRNA Sequence	AGGAGGAUGGAGAGCUGGGCCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon94	miR-7106 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7106	miRNA Mature ID	miR-7106-5p
miRNA Sequence	UGGGAGGAGGGGAUCUUGGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon95	miR-7154 directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7154	miRNA Mature ID	miR-7154-3p
miRNA Sequence	AGGAGGACAAGUUGUGGGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon96	miR-7157 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7157	miRNA Mature ID	miR-7157-5p
miRNA Sequence	UCAGCAUUCAUUGGCACCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon97	miR-7160 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7160	miRNA Mature ID	miR-7160-5p
miRNA Sequence	UGCUGAGGUCCGGGCUGUGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon98	miR-7162 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7162	miRNA Mature ID	miR-7162-3p
miRNA Sequence	UCUGAGGUGGAACAGCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon99	miR-744 directly targets SLC38A7			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-744	miRNA Mature ID	miR-744-3p
miRNA Sequence	CUGUUGCCACUAACCUCAACCU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon100	miR-765 directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-765	miRNA Mature ID	miR-765
miRNA Sequence	UGGAGGAGAAGGAAGGUGAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon101	miR-766 directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-5p
miRNA Sequence	AGGAGGAAUUGGUGCUGGUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon102	miR-7847 directly targets SLC38A7			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7847	miRNA Mature ID	miR-7847-3p
miRNA Sequence	CGUGGAGGACGAGGAGGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon103	miR-7856 directly targets SLC38A7			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7856	miRNA Mature ID	miR-7856-5p
miRNA Sequence	UUUUAAGGACACUGAGGGAUC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon104	miR-7977 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7977	miRNA Mature ID	miR-7977
miRNA Sequence	UUCCCAGCCAACGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon105	miR-876 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-876	miRNA Mature ID	miR-876-3p
miRNA Sequence	UGGUGGUUUACAAAGUAAUUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon106	miR-887 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-887	miRNA Mature ID	miR-887-5p
miRNA Sequence	CUUGGGAGCCCUGUUAGACUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon107	miR-92a-2 directly targets SLC38A7			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-92a-2	miRNA Mature ID	miR-92a-2-5p
miRNA Sequence	GGGUGGGGAUUUGUUGCAUUAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon108	miR-98 directly targets SLC38A7			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-98	miRNA Mature ID	miR-98-5p
miRNA Sequence	UGAGGUAGUAAGUUGUAUUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
14	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16	Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
17	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
18	Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
19	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
20	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
21	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
22	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence