General Information of Drug Transporter (DT)
DT ID DTD0334 Transporter Info
Gene Name SLC38A7
Transporter Name Putative sodium-coupled neutral amino acid transporter 7
Gene ID
55238
UniProt ID
Q9NVC3
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg05006947)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:4.11E-08; Z-score:1.24E+00

Methylation in Case

9.13E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg05830473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:4.82E-08; Z-score:1.56E+00

Methylation in Case

8.54E-01 (Median) Methylation in Control 6.66E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg06250214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.38E+00 Statistic Test p-value:5.76E-08; Z-score:-1.65E+00

Methylation in Case

1.20E-01 (Median) Methylation in Control 2.87E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg06696917)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:6.76E-08; Z-score:-1.28E+00

Methylation in Case

7.20E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg08855361)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:1.55E-07; Z-score:-1.46E+00

Methylation in Case

7.32E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg11933375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:3.41E-07; Z-score:1.23E+00

Methylation in Case

9.31E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg26758340)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.25E-05; Z-score:-7.33E-01

Methylation in Case

8.08E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg05876883)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.74E-03; Z-score:6.52E-01

Methylation in Case

9.22E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC38A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

3'UTR (cg27182807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:3.36E-09; Z-score:-1.71E+00

Methylation in Case

7.80E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in bladder cancer [ 2 ]

Location

5'UTR (cg06250214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:3.66E-05; Z-score:-1.85E+01

Methylation in Case

8.21E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in bladder cancer [ 2 ]

Location

5'UTR (cg11933375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:4.41E-05; Z-score:-1.14E+01

Methylation in Case

5.11E-02 (Median) Methylation in Control 6.21E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in bladder cancer [ 2 ]

Location

TSS1500 (cg07424912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:4.43E-03; Z-score:5.63E+00

Methylation in Case

7.21E-01 (Median) Methylation in Control 5.64E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in bladder cancer [ 2 ]

Location

3'UTR (cg27182807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.59E-04; Z-score:-4.43E+00

Methylation in Case

7.70E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in breast cancer [ 3 ]

Location

5'UTR (cg06250214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.20E-07; Z-score:-1.70E+00

Methylation in Case

8.56E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in breast cancer [ 3 ]

Location

TSS1500 (cg06073139)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.79E+00 Statistic Test p-value:3.19E-12; Z-score:2.71E+00

Methylation in Case

4.53E-01 (Median) Methylation in Control 2.53E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in breast cancer [ 3 ]

Location

TSS1500 (cg04229059)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:1.58E-06; Z-score:1.59E+00

Methylation in Case

2.11E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in breast cancer [ 3 ]

Location

TSS1500 (cg07424912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:6.70E-03; Z-score:7.85E-01

Methylation in Case

4.54E-01 (Median) Methylation in Control 3.96E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A7 in breast cancer [ 3 ]

Location

TSS200 (cg06320982)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.69E-02; Z-score:1.19E-01

Methylation in Case

8.20E-02 (Median) Methylation in Control 7.93E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg08855361)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.02E-04; Z-score:7.52E-01

Methylation in Case

5.27E-02 (Median) Methylation in Control 4.66E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg11933375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.30E-03; Z-score:8.54E-01

Methylation in Case

2.16E-02 (Median) Methylation in Control 1.86E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg26758340)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:2.76E-03; Z-score:3.06E+00

Methylation in Case

9.38E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

5'UTR (cg06696917)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.70E-02; Z-score:5.19E-01

Methylation in Case

3.18E-02 (Median) Methylation in Control 2.97E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg04229059)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:1.30E-04; Z-score:1.14E+00

Methylation in Case

2.23E-01 (Median) Methylation in Control 1.67E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A7 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg06320982)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.48E+00 Statistic Test p-value:2.43E-04; Z-score:1.01E+00

Methylation in Case

4.30E-02 (Median) Methylation in Control 2.91E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

5'UTR (cg17537007)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.48E-04; Z-score:-1.83E+00

Methylation in Case

7.82E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

Body (cg04491808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:3.11E-05; Z-score:-2.29E+00

Methylation in Case

5.16E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

Body (cg13939166)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:3.94E-05; Z-score:-2.48E+00

Methylation in Case

6.27E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

Body (cg23387310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:6.41E-05; Z-score:-3.67E+00

Methylation in Case

5.96E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

Body (cg21557445)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.47E-04; Z-score:-1.09E+00

Methylation in Case

8.21E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A7 in colon adenocarcinoma [ 5 ]

Location

Body (cg10369665)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:2.47E-03; Z-score:2.00E+00

Methylation in Case

6.57E-01 (Median) Methylation in Control 5.69E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

5'UTR (cg08855361)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:2.75E-05; Z-score:1.25E+00

Methylation in Case

4.39E-02 (Median) Methylation in Control 3.42E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

5'UTR (cg06250214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.10E-03; Z-score:-7.87E-01

Methylation in Case

9.33E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

5'UTR (cg05006947)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:5.04E-03; Z-score:-4.41E-01

Methylation in Case

5.49E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

5'UTR (cg26758340)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:6.94E-03; Z-score:-1.86E-01

Methylation in Case

9.22E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

TSS1500 (cg07424912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:5.66E-03; Z-score:-1.01E+00

Methylation in Case

5.33E-01 (Median) Methylation in Control 6.21E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

TSS1500 (cg04229059)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.10E-02; Z-score:6.02E-01

Methylation in Case

3.21E-01 (Median) Methylation in Control 2.86E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A7 in colorectal cancer [ 6 ]

Location

3'UTR (cg27182807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.74E-04; Z-score:-9.53E-01

Methylation in Case

8.97E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg26758340)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:5.90E-03; Z-score:8.71E-02

Methylation in Case

7.76E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg21384789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:5.25E-11; Z-score:-8.80E+00

Methylation in Case

6.49E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg06073139)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.64E-05; Z-score:-1.04E+00

Methylation in Case

3.71E-01 (Median) Methylation in Control 4.54E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg07424912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:3.72E-04; Z-score:-1.11E+00

Methylation in Case

3.35E-01 (Median) Methylation in Control 4.17E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg04229059)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:9.64E-03; Z-score:-8.43E-01

Methylation in Case

1.83E-01 (Median) Methylation in Control 2.04E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

TSS200 (cg06320982)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.19E-02; Z-score:-5.86E-01

Methylation in Case

7.54E-02 (Median) Methylation in Control 8.89E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A7 in hepatocellular carcinoma [ 7 ]

Location

Body (cg22414192)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.55E+00 Statistic Test p-value:7.49E-14; Z-score:-9.03E+00

Methylation in Case

6.08E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in HIV infection [ 8 ]

Location

5'UTR (cg11933375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:7.19E-03; Z-score:9.54E-01

Methylation in Case

7.40E-02 (Median) Methylation in Control 5.96E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in HIV infection [ 8 ]

Location

5'UTR (cg08855361)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:2.07E-02; Z-score:8.63E-01

Methylation in Case

1.47E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in HIV infection [ 8 ]

Location

5'UTR (cg05006947)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:4.46E-02; Z-score:7.29E-01

Methylation in Case

1.29E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in HIV infection [ 8 ]

Location

TSS1500 (cg07424912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.98E-02; Z-score:4.51E-01

Methylation in Case

9.45E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A7 in HIV infection [ 8 ]

Location

TSS200 (cg06320982)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:1.49E-06; Z-score:1.94E+00

Methylation in Case

1.69E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg05830473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:3.42E-02; Z-score:-1.63E+00

Methylation in Case

1.35E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg06073139)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.54E-02; Z-score:2.08E+00

Methylation in Case

6.29E-01 (Median) Methylation in Control 5.42E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in papillary thyroid cancer [ 10 ]

Location

5'UTR (cg11933375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:7.71E-03; Z-score:-8.13E-01

Methylation in Case

5.81E-02 (Median) Methylation in Control 6.51E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in papillary thyroid cancer [ 10 ]

Location

TSS1500 (cg06073139)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:2.77E-02; Z-score:8.00E-01

Methylation in Case

4.56E-01 (Median) Methylation in Control 4.03E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in papillary thyroid cancer [ 10 ]

Location

TSS200 (cg06320982)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:8.39E-04; Z-score:6.86E-01

Methylation in Case

5.79E-02 (Median) Methylation in Control 5.14E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in papillary thyroid cancer [ 10 ]

Location

3'UTR (cg27182807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.26E-03; Z-score:-8.34E-01

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in systemic lupus erythematosus [ 11 ]

Location

5'UTR (cg08855361)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.69E-02; Z-score:9.69E-02

Methylation in Case

9.14E-02 (Median) Methylation in Control 8.89E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in systemic lupus erythematosus [ 11 ]

Location

5'UTR (cg05006947)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.88E-02; Z-score:1.79E-01

Methylation in Case

5.81E-02 (Median) Methylation in Control 5.49E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in systemic lupus erythematosus [ 11 ]

Location

TSS1500 (cg04229059)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.40E-02; Z-score:-2.03E-01

Methylation in Case

4.52E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in depression [ 12 ]

Location

TSS1500 (cg07424912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.27E-02; Z-score:-1.34E-01

Methylation in Case

8.79E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in pancretic ductal adenocarcinoma [ 13 ]

Location

TSS1500 (cg03556497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.18E+00 Statistic Test p-value:2.21E-25; Z-score:3.99E+00

Methylation in Case

3.27E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A7 in pancretic ductal adenocarcinoma [ 13 ]

Location

TSS1500 (cg07992308)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.24E-03; Z-score:-4.44E-01

Methylation in Case

5.31E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A7 in pancretic ductal adenocarcinoma [ 13 ]

Location

Body (cg10156714)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.82E-13; Z-score:-1.80E+00

Methylation in Case

8.21E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A7 in pancretic ductal adenocarcinoma [ 13 ]

Location

Body (cg15192909)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.03E-02; Z-score:-3.22E-01

Methylation in Case

4.85E-01 (Median) Methylation in Control 4.96E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in panic disorder [ 14 ]

Location

TSS1500 (cg07424912)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.69E-02; Z-score:2.54E-01

Methylation in Case

3.94E+00 (Median) Methylation in Control 3.83E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A7 in prostate cancer [ 15 ]

Location

Body (cg14518227)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.83E+00 Statistic Test p-value:1.54E-02; Z-score:-3.46E+00

Methylation in Case

4.39E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

       108 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

let-7a directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

let-7a miRNA Mature ID let-7a-5p

miRNA Sequence

UGAGGUAGUAGGUUGUAUAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

let-7b directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

let-7c directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

let-7c miRNA Mature ID let-7c-5p

miRNA Sequence

UGAGGUAGUAGGUUGUAUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

let-7d directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

let-7d miRNA Mature ID let-7d-5p

miRNA Sequence

AGAGGUAGUAGGUUGCAUAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

let-7e directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

let-7f directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

let-7f miRNA Mature ID let-7f-5p

miRNA Sequence

UGAGGUAGUAGAUUGUAUAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

let-7g directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

let-7g miRNA Mature ID let-7g-5p

miRNA Sequence

UGAGGUAGUAGUUUGUACAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

let-7i directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

let-7i miRNA Mature ID let-7i-5p

miRNA Sequence

UGAGGUAGUAGUUUGUGCUGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-1271 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1271 miRNA Mature ID miR-1271-3p

miRNA Sequence

AGUGCCUGCUAUGUGCCAGGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-1273h directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1273h miRNA Mature ID miR-1273h-5p

miRNA Sequence

CUGGGAGGUCAAGGCUGCAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-141 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-141 miRNA Mature ID miR-141-5p

miRNA Sequence

CAUCUUCCAGUACAGUGUUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-149 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-149 miRNA Mature ID miR-149-3p

miRNA Sequence

AGGGAGGGACGGGGGCUGUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-193b directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-193b miRNA Mature ID miR-193b-5p

miRNA Sequence

CGGGGUUUUGAGGGCGAGAUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

miR-19a directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19a miRNA Mature ID miR-19a-5p

miRNA Sequence

AGUUUUGCAUAGUUGCACUACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

miR-19b-1 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19b-1 miRNA Mature ID miR-19b-1-5p

miRNA Sequence

AGUUUUGCAGGUUUGCAUCCAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-19b-2 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19b-2 miRNA Mature ID miR-19b-2-5p

miRNA Sequence

AGUUUUGCAGGUUUGCAUUUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-202 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-202 miRNA Mature ID miR-202-3p

miRNA Sequence

AGAGGUAUAGGGCAUGGGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-204 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-204 miRNA Mature ID miR-204-5p

miRNA Sequence

UUCCCUUUGUCAUCCUAUGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-211 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-211 miRNA Mature ID miR-211-5p

miRNA Sequence

UUCCCUUUGUCAUCCUUCGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-214 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-214 miRNA Mature ID miR-214-5p

miRNA Sequence

UGCCUGUCUACACUUGCUGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-29a directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29a miRNA Mature ID miR-29a-5p

miRNA Sequence

ACUGAUUUCUUUUGGUGUUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-30a directly targets SLC38A7 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-30b directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30b miRNA Mature ID miR-30b-3p

miRNA Sequence

CUGGGAGGUGGAUGUUUACUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

miR-30b directly targets SLC38A7 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30b miRNA Mature ID miR-30b-5p

miRNA Sequence

UGUAAACAUCCUACACUCAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-30c directly targets SLC38A7 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30c miRNA Mature ID miR-30c-5p

miRNA Sequence

UGUAAACAUCCUACACUCUCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-30c-1 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30c-1 miRNA Mature ID miR-30c-1-3p

miRNA Sequence

CUGGGAGAGGGUUGUUUACUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-30c-2 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30c-2 miRNA Mature ID miR-30c-2-3p

miRNA Sequence

CUGGGAGAAGGCUGUUUACUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-30d directly targets SLC38A7 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30d miRNA Mature ID miR-30d-5p

miRNA Sequence

UGUAAACAUCCCCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-30e directly targets SLC38A7 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30e miRNA Mature ID miR-30e-5p

miRNA Sequence

UGUAAACAUCCUUGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-3122 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3122 miRNA Mature ID miR-3122

miRNA Sequence

GUUGGGACAAGAGGACGGUCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon31

miR-3170 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3170 miRNA Mature ID miR-3170

miRNA Sequence

CUGGGGUUCUGAGACAGACAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

miR-3187 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3187 miRNA Mature ID miR-3187-3p

miRNA Sequence

UUGGCCAUGGGGCUGCGCGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon33

miR-323a directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-323a miRNA Mature ID miR-323a-5p

miRNA Sequence

AGGUGGUCCGUGGCGCGUUCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-3658 directly targets SLC38A7 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3658 miRNA Mature ID miR-3658

miRNA Sequence

UUUAAGAAAACACCAUGGAGAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon35

miR-3689a directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3689a miRNA Mature ID miR-3689a-3p

miRNA Sequence

CUGGGAGGUGUGAUAUCGUGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon36

miR-3689b directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3689b miRNA Mature ID miR-3689b-3p

miRNA Sequence

CUGGGAGGUGUGAUAUUGUGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon37

miR-3689c directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3689c miRNA Mature ID miR-3689c

miRNA Sequence

CUGGGAGGUGUGAUAUUGUGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

miR-3913 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3913 miRNA Mature ID miR-3913-5p

miRNA Sequence

UUUGGGACUGAUCUUGAUGUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

miR-3920 directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3920 miRNA Mature ID miR-3920

miRNA Sequence

ACUGAUUAUCUUAACUCUCUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-3929 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-411 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-411 miRNA Mature ID miR-411-5p

miRNA Sequence

UAGUAGACCGUAUAGCGUACG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-4291 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4291 miRNA Mature ID miR-4291

miRNA Sequence

UUCAGCAGGAACAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-4310 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4310 miRNA Mature ID miR-4310

miRNA Sequence

GCAGCAUUCAUGUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-4423 directly targets SLC38A7 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4423 miRNA Mature ID miR-4423-5p

miRNA Sequence

AGUUGCCUUUUUGUUCCCAUGC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon45

miR-4435 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4435 miRNA Mature ID miR-4435

miRNA Sequence

AUGGCCAGAGCUCACACAGAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

miR-4458 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4458 miRNA Mature ID miR-4458

miRNA Sequence

AGAGGUAGGUGUGGAAGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-4477a directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4477a miRNA Mature ID miR-4477a

miRNA Sequence

CUAUUAAGGACAUUUGUGAUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-4478 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

GAGGCUGAGCUGAGGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon49

miR-4500 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4500 miRNA Mature ID miR-4500

miRNA Sequence

UGAGGUAGUAGUUUCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon50

miR-4524a directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4524a miRNA Mature ID miR-4524a-3p

miRNA Sequence

UGAGACAGGCUUAUGCUGCUAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-4524b directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4524b miRNA Mature ID miR-4524b-3p

miRNA Sequence

GAGACAGGUUCAUGCUGCUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-4639 directly targets SLC38A7 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4639 miRNA Mature ID miR-4639-3p

miRNA Sequence

UCACUCUCACCUUGCUUUGC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon53

miR-4701 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4701 miRNA Mature ID miR-4701-5p

miRNA Sequence

UUGGCCACCACACCUACCCCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon54

miR-4721 directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4721 miRNA Mature ID miR-4721

miRNA Sequence

UGAGGGCUCCAGGUGACGGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon55

miR-4728 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4728 miRNA Mature ID miR-4728-5p

miRNA Sequence

UGGGAGGGGAGAGGCAGCAAGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon56

miR-4755 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4755 miRNA Mature ID miR-4755-5p

miRNA Sequence

UUUCCCUUCAGAGCCUGGCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-4755 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4755 miRNA Mature ID miR-4755-3p

miRNA Sequence

AGCCAGGCUCUGAAGGGAAAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon58

miR-4781 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4781 miRNA Mature ID miR-4781-3p

miRNA Sequence

AAUGUUGGAAUCCUCGCUAGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-485 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon60

miR-5002 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5002 miRNA Mature ID miR-5002-5p

miRNA Sequence

AAUUUGGUUUCUGAGGCACUUAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon61

miR-5006 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5006 miRNA Mature ID miR-5006-3p

miRNA Sequence

UUUCCCUUUCCAUCCUGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon62

miR-516a directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-516a miRNA Mature ID miR-516a-5p

miRNA Sequence

UUCUCGAGGAAAGAAGCACUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon63

miR-541 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-541 miRNA Mature ID miR-541-3p

miRNA Sequence

UGGUGGGCACAGAAUCUGGACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon64

miR-548s directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548s miRNA Mature ID miR-548s

miRNA Sequence

AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon65

miR-550a directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-550a miRNA Mature ID miR-550a-5p

miRNA Sequence

AGUGCCUGAGGGAGUAAGAGCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon66

miR-588 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-588 miRNA Mature ID miR-588

miRNA Sequence

UUGGCCACAAUGGGUUAGAAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon67

miR-615 directly targets SLC38A7 [ 22 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon68

miR-623 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-623 miRNA Mature ID miR-623

miRNA Sequence

AUCCCUUGCAGGGGCUGUUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon69

miR-6501 directly targets SLC38A7 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6501 miRNA Mature ID miR-6501-5p

miRNA Sequence

AGUUGCCAGGGCUGCCUUUGGU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon70

miR-6513 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6513 miRNA Mature ID miR-6513-5p

miRNA Sequence

UUUGGGAUUGACGCCACAUGUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon71

miR-6514 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6514 miRNA Mature ID miR-6514-3p

miRNA Sequence

CUGCCUGUUCUUCCACUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon72

miR-654 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-654 miRNA Mature ID miR-654-5p

miRNA Sequence

UGGUGGGCCGCAGAACAUGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon73

miR-665 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon74

miR-6741 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6741 miRNA Mature ID miR-6741-5p

miRNA Sequence

GUGGGUGCUGGUGGGAGCCGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon75

miR-6748 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6748 miRNA Mature ID miR-6748-5p

miRNA Sequence

UGUGGGUGGGAAGGACUGGAUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon76

miR-6769a directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6769a miRNA Mature ID miR-6769a-5p

miRNA Sequence

AGGUGGGUAUGGAGGAGCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon77

miR-6769b directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6769b miRNA Mature ID miR-6769b-5p

miRNA Sequence

UGGUGGGUGGGGAGGAGAAGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon78

miR-6779 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6779 miRNA Mature ID miR-6779-5p

miRNA Sequence

CUGGGAGGGGCUGGGUUUGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon79

miR-6780a directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6780a miRNA Mature ID miR-6780a-5p

miRNA Sequence

UUGGGAGGGAAGACAGCUGGAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon80

miR-6785 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6785 miRNA Mature ID miR-6785-5p

miRNA Sequence

UGGGAGGGCGUGGAUGAUGGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon81

miR-6788 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6788 miRNA Mature ID miR-6788-5p

miRNA Sequence

CUGGGAGAAGAGUGGUGAAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon82

miR-6794 directly targets SLC38A7 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6794 miRNA Mature ID miR-6794-3p

miRNA Sequence

CUCACUCUCAGUCCCUCCCU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon83

miR-6799 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6799 miRNA Mature ID miR-6799-5p

miRNA Sequence

GGGGAGGUGUGCAGGGCUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon84

miR-6811 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6811 miRNA Mature ID miR-6811-3p

miRNA Sequence

AGCCUGUGCUUGUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon85

miR-6823 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6823 miRNA Mature ID miR-6823-5p

miRNA Sequence

UCAGGGUUGGUAGGGGUUGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon86

miR-6832 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6832 miRNA Mature ID miR-6832-5p

miRNA Sequence

AGUAGAGAGGAAAAGUUAGGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon87

miR-6855 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6855 miRNA Mature ID miR-6855-5p

miRNA Sequence

UUGGGGUUUGGGGUGCAGACAUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon88

miR-6880 directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6880 miRNA Mature ID miR-6880-5p

miRNA Sequence

UGGUGGAGGAAGAGGGCAGCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon89

miR-6883 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6883 miRNA Mature ID miR-6883-5p

miRNA Sequence

AGGGAGGGUGUGGUAUGGAUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon90

miR-6884 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon91

miR-6888 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6888 miRNA Mature ID miR-6888-5p

miRNA Sequence

AAGGAGAUGCUCAGGCAGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon92

miR-6890 directly targets SLC38A7 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6890 miRNA Mature ID miR-6890-5p

miRNA Sequence

CAUGGGGUAGGGCAGAGUAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon93

miR-6894 directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6894 miRNA Mature ID miR-6894-5p

miRNA Sequence

AGGAGGAUGGAGAGCUGGGCCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon94

miR-7106 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon95

miR-7154 directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7154 miRNA Mature ID miR-7154-3p

miRNA Sequence

AGGAGGACAAGUUGUGGGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon96

miR-7157 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7157 miRNA Mature ID miR-7157-5p

miRNA Sequence

UCAGCAUUCAUUGGCACCAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon97

miR-7160 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7160 miRNA Mature ID miR-7160-5p

miRNA Sequence

UGCUGAGGUCCGGGCUGUGCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon98

miR-7162 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7162 miRNA Mature ID miR-7162-3p

miRNA Sequence

UCUGAGGUGGAACAGCAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon99

miR-744 directly targets SLC38A7 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-744 miRNA Mature ID miR-744-3p

miRNA Sequence

CUGUUGCCACUAACCUCAACCU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon100

miR-765 directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-765 miRNA Mature ID miR-765

miRNA Sequence

UGGAGGAGAAGGAAGGUGAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon101

miR-766 directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-766 miRNA Mature ID miR-766-5p

miRNA Sequence

AGGAGGAAUUGGUGCUGGUCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon102

miR-7847 directly targets SLC38A7 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7847 miRNA Mature ID miR-7847-3p

miRNA Sequence

CGUGGAGGACGAGGAGGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon103

miR-7856 directly targets SLC38A7 [ 21 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7856 miRNA Mature ID miR-7856-5p

miRNA Sequence

UUUUAAGGACACUGAGGGAUC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon104

miR-7977 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

UUCCCAGCCAACGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon105

miR-876 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-876 miRNA Mature ID miR-876-3p

miRNA Sequence

UGGUGGUUUACAAAGUAAUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon106

miR-887 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-887 miRNA Mature ID miR-887-5p

miRNA Sequence

CUUGGGAGCCCUGUUAGACUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon107

miR-92a-2 directly targets SLC38A7 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-92a-2 miRNA Mature ID miR-92a-2-5p

miRNA Sequence

GGGUGGGGAUUUGUUGCAUUAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon108

miR-98 directly targets SLC38A7 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
14 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16 Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
17 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
18 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
19 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
20 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
21 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
22 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.