General Information of Drug Transporter (DT)
DT ID DTD0333 Transporter Info
Gene Name SLC38A6
Transporter Name Probable sodium-coupled neutral amino acid transporter 6
Gene ID
145389
UniProt ID
Q8IZM9
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A6 in hepatocellular carcinoma [ 1 ]

Location

TSS200 (cg15360181)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.52E+00 Statistic Test p-value:1.13E-18; Z-score:-2.42E+00

Methylation in Case

1.37E-01 (Median) Methylation in Control 3.47E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A6 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg09961663)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:1.27E-02; Z-score:-7.76E-01

Methylation in Case

1.37E-01 (Median) Methylation in Control 1.83E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A6 in bladder cancer [ 3 ]

Location

Body (cg23134075)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.87E-02; Z-score:1.51E+00

Methylation in Case

8.78E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A6 in bladder cancer [ 3 ]

Location

Body (cg18268220)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:4.94E-02; Z-score:-1.04E+00

Methylation in Case

1.46E-01 (Median) Methylation in Control 1.79E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A6 in breast cancer [ 4 ]

Location

Body (cg18268220)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:7.29E-04; Z-score:8.88E-01

Methylation in Case

1.96E-01 (Median) Methylation in Control 1.71E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  HIV infection

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A6 in HIV infection [ 5 ]

Location

Body (cg18268220)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.28E-02; Z-score:2.05E-01

Methylation in Case

3.67E-01 (Median) Methylation in Control 3.55E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A6 in lung adenocarcinoma [ 6 ]

Location

Body (cg23134075)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.41E-03; Z-score:1.61E+00

Methylation in Case

8.74E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A6 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg01385052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:3.65E-05; Z-score:1.16E+00

Methylation in Case

4.48E-01 (Median) Methylation in Control 3.87E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A6 in papillary thyroid cancer [ 8 ]

Location

Body (cg09961663)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.94E-02; Z-score:-4.85E-01

Methylation in Case

9.18E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-26b directly targets SLC38A6 [ 9 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.