Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0332 Transporter Info
Gene Name	SLC38A5
Transporter Name	Sodium-coupled neutral amino acid transporter 5
Gene ID	92745
UniProt ID	Q8WUX1

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg02151779)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:1.20E-08; Z-score:-1.86E+00
Methylation in Case	5.11E-01 (Median)	Methylation in Control	6.85E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg14522327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:9.24E-07; Z-score:1.46E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	6.82E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg17590101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.36E+00	Statistic Test	p-value:2.10E-06; Z-score:1.44E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	4.73E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg19407886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:2.98E-06; Z-score:1.19E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg20495737)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:4.22E-06; Z-score:1.16E+00
Methylation in Case	8.90E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg24152857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:8.01E-06; Z-score:1.25E+00
Methylation in Case	7.99E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg04700811)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.48E+00	Statistic Test	p-value:3.19E-14; Z-score:-2.13E+00
Methylation in Case	4.24E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg23948362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:1.20E-09; Z-score:-1.96E+00
Methylation in Case	7.36E-01 (Median)	Methylation in Control	8.84E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A5 in bladder cancer			[ 2 ]
Location	5'UTR (cg19407886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:3.86E-12; Z-score:-1.75E+01
Methylation in Case	3.25E-01 (Median)	Methylation in Control	5.16E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A5 in bladder cancer			[ 2 ]
Location	TSS1500 (cg18492059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.16E+00	Statistic Test	p-value:8.37E-09; Z-score:-8.60E+00
Methylation in Case	3.04E-01 (Median)	Methylation in Control	6.56E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A5 in bladder cancer			[ 2 ]
Location	TSS1500 (cg26735834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.49E+00	Statistic Test	p-value:4.02E-06; Z-score:-4.28E+00
Methylation in Case	5.17E-01 (Median)	Methylation in Control	7.68E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A5 in bladder cancer			[ 2 ]
Location	TSS1500 (cg03021892)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:5.53E-06; Z-score:-4.15E+00
Methylation in Case	6.01E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A5 in bladder cancer			[ 2 ]
Location	TSS200 (cg16536563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:5.35E-06; Z-score:-9.12E+00
Methylation in Case	6.14E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A5 in bladder cancer			[ 2 ]
Location	TSS200 (cg21197919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:6.58E-06; Z-score:-8.08E+00
Methylation in Case	6.56E-01 (Median)	Methylation in Control	8.06E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A5 in bladder cancer			[ 2 ]
Location	Body (cg24455325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.84E+00	Statistic Test	p-value:5.72E-07; Z-score:-2.84E+01
Methylation in Case	2.82E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A5 in bladder cancer			[ 2 ]
Location	3'UTR (cg23948362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:1.35E-03; Z-score:-2.25E+00
Methylation in Case	4.84E-01 (Median)	Methylation in Control	6.07E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A5 in breast cancer			[ 3 ]
Location	5'UTR (cg19407886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.22E-05; Z-score:-9.86E-01
Methylation in Case	3.99E-01 (Median)	Methylation in Control	4.28E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A5 in breast cancer			[ 3 ]
Location	5'UTR (cg14522327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:6.13E-03; Z-score:6.41E-01
Methylation in Case	4.14E-01 (Median)	Methylation in Control	3.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A5 in breast cancer			[ 3 ]
Location	5'UTR (cg17590101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.03E-02; Z-score:-7.40E-01
Methylation in Case	6.91E-01 (Median)	Methylation in Control	7.35E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A5 in breast cancer			[ 3 ]
Location	5'UTR (cg20495737)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:4.69E-02; Z-score:-7.84E-01
Methylation in Case	5.47E-01 (Median)	Methylation in Control	6.19E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg26735834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:3.15E-05; Z-score:-1.02E+00
Methylation in Case	5.98E-01 (Median)	Methylation in Control	6.52E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg18492059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:3.51E-04; Z-score:-7.43E-01
Methylation in Case	5.11E-01 (Median)	Methylation in Control	5.55E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A5 in breast cancer			[ 3 ]
Location	3'UTR (cg23948362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.25E-02; Z-score:-9.14E-01
Methylation in Case	5.59E-01 (Median)	Methylation in Control	5.93E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	5'UTR (cg19407886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:2.79E-07; Z-score:-1.47E+00
Methylation in Case	4.33E-01 (Median)	Methylation in Control	5.40E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	5'UTR (cg14522327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.53E+00	Statistic Test	p-value:1.28E-02; Z-score:4.42E-01
Methylation in Case	1.53E-01 (Median)	Methylation in Control	9.99E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	5'UTR (cg20495737)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:2.65E-02; Z-score:9.14E-01
Methylation in Case	4.89E-01 (Median)	Methylation in Control	3.99E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg03021892)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:5.04E-09; Z-score:-1.67E+00
Methylation in Case	6.67E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg18492059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.29E-05; Z-score:-8.83E-01
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg26735834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.93E-03; Z-score:-2.38E-01
Methylation in Case	8.67E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	TSS200 (cg21197919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:4.49E-07; Z-score:-1.32E+00
Methylation in Case	7.21E-01 (Median)	Methylation in Control	8.08E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	TSS200 (cg16536563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:5.90E-05; Z-score:-8.77E-01
Methylation in Case	7.29E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg24455325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:1.67E-08; Z-score:-1.90E+00
Methylation in Case	5.91E-01 (Median)	Methylation in Control	6.96E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC38A5 in hepatocellular carcinoma			[ 4 ]
Location	3'UTR (cg04700811)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:8.62E-07; Z-score:-1.32E+00
Methylation in Case	8.11E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	5'UTR (cg20495737)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-3.89E+00	Statistic Test	p-value:5.21E-04; Z-score:-1.92E+00
Methylation in Case	1.25E-01 (Median)	Methylation in Control	4.87E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	5'UTR (cg17590101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-4.17E+00	Statistic Test	p-value:6.18E-04; Z-score:-1.87E+00
Methylation in Case	1.46E-01 (Median)	Methylation in Control	6.09E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	5'UTR (cg14522327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-5.82E+00	Statistic Test	p-value:1.72E-03; Z-score:-1.58E+00
Methylation in Case	6.13E-02 (Median)	Methylation in Control	3.57E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	5'UTR (cg24152857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-6.08E+00	Statistic Test	p-value:2.28E-03; Z-score:-1.63E+00
Methylation in Case	5.20E-02 (Median)	Methylation in Control	3.16E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	5'UTR (cg02151779)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-4.87E+00	Statistic Test	p-value:3.40E-03; Z-score:-1.65E+00
Methylation in Case	4.26E-02 (Median)	Methylation in Control	2.07E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	5'UTR (cg19407886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.39E-02; Z-score:3.19E-01
Methylation in Case	4.63E-01 (Median)	Methylation in Control	4.51E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	TSS1500 (cg03021892)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.22E-04; Z-score:7.14E-01
Methylation in Case	9.07E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	TSS1500 (cg18492059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.85E-03; Z-score:1.01E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	TSS1500 (cg26735834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:8.96E-03; Z-score:6.95E-01
Methylation in Case	9.00E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	TSS200 (cg16536563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:6.58E-06; Z-score:9.46E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	TSS200 (cg21197919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:4.07E-04; Z-score:7.88E-01
Methylation in Case	8.82E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	3'UTR (cg23948362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.68E-04; Z-score:1.12E+00
Methylation in Case	9.12E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC38A5 in HIV infection			[ 5 ]
Location	3'UTR (cg04700811)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:2.50E-03; Z-score:1.05E+00
Methylation in Case	9.38E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A5 in systemic lupus erythematosus			[ 6 ]
Location	5'UTR (cg19407886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.42E-04; Z-score:-3.23E-01
Methylation in Case	5.00E-01 (Median)	Methylation in Control	5.20E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A5 in systemic lupus erythematosus			[ 6 ]
Location	5'UTR (cg14522327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.07E-02; Z-score:1.16E-01
Methylation in Case	4.58E-01 (Median)	Methylation in Control	4.40E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A5 in systemic lupus erythematosus			[ 6 ]
Location	5'UTR (cg24152857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.50E-02; Z-score:8.83E-02
Methylation in Case	3.68E-01 (Median)	Methylation in Control	3.56E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A5 in systemic lupus erythematosus			[ 6 ]
Location	TSS1500 (cg03021892)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.45E-04; Z-score:-3.94E-01
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A5 in systemic lupus erythematosus			[ 6 ]
Location	TSS200 (cg16536563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.62E-03; Z-score:-3.19E-01
Methylation in Case	7.80E-01 (Median)	Methylation in Control	7.98E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A5 in systemic lupus erythematosus			[ 6 ]
Location	Body (cg24455325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.79E-02; Z-score:-2.00E-01
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A5 in systemic lupus erythematosus			[ 6 ]
Location	3'UTR (cg23948362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.99E-03; Z-score:-3.06E-01
Methylation in Case	8.13E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC38A5 in systemic lupus erythematosus			[ 6 ]
Location	3'UTR (cg04700811)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:5.24E-03; Z-score:-1.48E-01
Methylation in Case	9.02E-01 (Median)	Methylation in Control	9.05E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Colorectal cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A5 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg03021892)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.92E-05; Z-score:-1.57E+00
Methylation in Case	7.97E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A5 in colorectal cancer			[ 7 ]
Location	TSS1500 (cg18492059)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:8.56E-04; Z-score:-5.59E-01
Methylation in Case	8.76E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A5 in colorectal cancer			[ 7 ]
Location	TSS200 (cg21197919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.77E-02; Z-score:-2.71E-01
Methylation in Case	7.43E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A5 in colorectal cancer			[ 7 ]
Location	Body (cg24455325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:7.46E-03; Z-score:-6.43E-01
Methylation in Case	8.40E-01 (Median)	Methylation in Control	8.70E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A5 in colorectal cancer			[ 7 ]
Location	3'UTR (cg23948362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:4.40E-02; Z-score:1.60E-02
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC38A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg14014225)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:1.27E-07; Z-score:1.86E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	6.16E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC38A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg24682551)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:5.49E-08; Z-score:-1.08E+00
Methylation in Case	2.89E-01 (Median)	Methylation in Control	3.68E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC38A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg24944109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:9.21E-06; Z-score:7.27E-01
Methylation in Case	2.91E-01 (Median)	Methylation in Control	2.47E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC38A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg01992487)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.10E-03; Z-score:1.14E+00
Methylation in Case	4.50E-01 (Median)	Methylation in Control	3.87E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC38A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg10091752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:2.88E-03; Z-score:7.10E-01
Methylation in Case	3.81E-01 (Median)	Methylation in Control	3.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC38A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg12835313)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:6.42E-03; Z-score:-6.74E-01
Methylation in Case	7.26E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC38A5 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg21732977)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:2.30E-02; Z-score:-7.33E-01
Methylation in Case	4.45E-02 (Median)	Methylation in Control	5.29E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate/moderate hypomethylation of SLC38A5 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.005929079; Fold-change:-0.267144341; Z-score:-0.850938106
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value:9.96E-14; Fold-change:-0.277234234; Z-score:-4.674285843
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC38A5 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.000199202; Fold-change:-0.347882468; Z-score:-1.963120564
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC38A5 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:9.00E-26; Fold-change:-0.449897408; Z-score:-3.516170859
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	31 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	let-7b directly targets SLC38A5			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	Proteomics
miRNA Stemloop ID	let-7b	miRNA Mature ID	let-7b-5p
miRNA Sequence	UGAGGUAGUAGGUUGUGUGGUU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon2	miR-124 directly targets SLC38A5			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-3p
miRNA Sequence	UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon3	miR-1281 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1281	miRNA Mature ID	miR-1281
miRNA Sequence	UCGCCUCCUCCUCUCCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon4	miR-155 directly targets SLC38A5			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	Proteomics
miRNA Stemloop ID	miR-155	miRNA Mature ID	miR-155-5p
miRNA Sequence	UUAAUGCUAAUCGUGAUAGGGGUU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon5	miR-16 directly targets SLC38A5			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	pSILAC//Proteomics;Other
miRNA Stemloop ID	miR-16	miRNA Mature ID	miR-16-5p
miRNA Sequence	UAGCAGCACGUAAAUAUUGGCG
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon6	miR-193b directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-193b	miRNA Mature ID	miR-193b-5p
miRNA Sequence	CGGGGUUUUGAGGGCGAGAUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-2116 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2116	miRNA Mature ID	miR-2116-3p
miRNA Sequence	CCUCCCAUGCCAAGAACUCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-30a directly targets SLC38A5			[ 9 ]
Epigenetic Type	microRNA	Experiment Method	Proteomics
miRNA Stemloop ID	miR-30a	miRNA Mature ID	miR-30a-5p
miRNA Sequence	UGUAAACAUCCUCGACUGGAAG
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon9	miR-3170 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3170	miRNA Mature ID	miR-3170
miRNA Sequence	CUGGGGUUCUGAGACAGACAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-3176 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3176	miRNA Mature ID	miR-3176
miRNA Sequence	ACUGGCCUGGGACUACCGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon11	miR-3661 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3661	miRNA Mature ID	miR-3661
miRNA Sequence	UGACCUGGGACUCGGACAGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-3922 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3922	miRNA Mature ID	miR-3922-3p
miRNA Sequence	UCUGGCCUUGACUUGACUCUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon13	miR-4691 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4691	miRNA Mature ID	miR-4691-5p
miRNA Sequence	GUCCUCCAGGCCAUGAGCUGCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-4733 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4733	miRNA Mature ID	miR-4733-3p
miRNA Sequence	CCACCAGGUCUAGCAUUGGGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-4757 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4757	miRNA Mature ID	miR-4757-5p
miRNA Sequence	AGGCCUCUGUGACGUCACGGUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon16	miR-4778 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4778	miRNA Mature ID	miR-4778-3p
miRNA Sequence	UCUUCUUCCUUUGCAGAGUUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-492 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-492	miRNA Mature ID	miR-492
miRNA Sequence	AGGACCUGCGGGACAAGAUUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-5193 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5193	miRNA Mature ID	miR-5193
miRNA Sequence	UCCUCCUCUACCUCAUCCCAGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon19	miR-631 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-631	miRNA Mature ID	miR-631
miRNA Sequence	AGACCUGGCCCAGACCUCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-660 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-660	miRNA Mature ID	miR-660-3p
miRNA Sequence	ACCUCCUGUGUGCAUGGAUUA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon21	miR-6744 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6744	miRNA Mature ID	miR-6744-3p
miRNA Sequence	GGGCCUCUCUUGUCAUCCUGCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon22	miR-6749 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6749	miRNA Mature ID	miR-6749-3p
miRNA Sequence	CUCCUCCCCUGCCUGGCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-6791 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6791	miRNA Mature ID	miR-6791-3p
miRNA Sequence	UGCCUCCUUGGUCUCCGGCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon24	miR-6792 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6792	miRNA Mature ID	miR-6792-3p
miRNA Sequence	CUCCUCCACAGCCCCUGCUCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-6829 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6829	miRNA Mature ID	miR-6829-3p
miRNA Sequence	UGCCUCCUCCGUGGCCUCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon26	miR-6855 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6855	miRNA Mature ID	miR-6855-5p
miRNA Sequence	UUGGGGUUUGGGGUGCAGACAUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-6875 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6875	miRNA Mature ID	miR-6875-3p
miRNA Sequence	AUUCUUCCUGCCCUGGCUCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-6878 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6878	miRNA Mature ID	miR-6878-3p
miRNA Sequence	CUGGCCUCUUCUUUCUCCUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon29	miR-6881 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6881	miRNA Mature ID	miR-6881-3p
miRNA Sequence	AUCCUCUUUCGUCCUUCCCACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon30	miR-6890 directly targets SLC38A5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6890	miRNA Mature ID	miR-6890-5p
miRNA Sequence	CAUGGGGUAGGGCAGAGUAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-877 directly targets SLC38A5			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-877	miRNA Mature ID	miR-877-3p
miRNA Sequence	UCCUCUUCUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9	Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
10	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
11	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
12	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence