General Information of Drug Transporter (DT)
DT ID DTD0329 Transporter Info
Gene Name SLC38A2
Transporter Name Sodium-coupled neutral amino acid transporter 2
Gene ID
54407
UniProt ID
Q96QD8
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg09973502)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:1.96E-07; Z-score:-1.19E+00

Methylation in Case

1.84E-01 (Median) Methylation in Control 2.70E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg10891888)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.81E-07; Z-score:-1.12E+00

Methylation in Case

7.31E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

5'UTR (cg13591723)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:5.78E-07; Z-score:-9.74E-01

Methylation in Case

7.78E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

Body (cg09050775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:8.94E-03; Z-score:-5.98E-01

Methylation in Case

7.39E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

3'UTR (cg23334507)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:9.44E-10; Z-score:1.76E+00

Methylation in Case

8.44E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in clear cell renal cell carcinoma [ 2 ]

Location

5'UTR (cg13591723)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.65E-02; Z-score:5.81E-01

Methylation in Case

1.16E-02 (Median) Methylation in Control 1.03E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in clear cell renal cell carcinoma [ 2 ]

Location

TSS1500 (cg07688749)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:5.82E-07; Z-score:1.25E+00

Methylation in Case

2.88E-02 (Median) Methylation in Control 2.32E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in clear cell renal cell carcinoma [ 2 ]

Location

TSS1500 (cg20408693)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:3.90E-05; Z-score:2.12E+00

Methylation in Case

4.12E-02 (Median) Methylation in Control 2.87E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

5'UTR (cg09973502)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:1.97E-07; Z-score:1.19E+00

Methylation in Case

8.81E-02 (Median) Methylation in Control 7.75E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

5'UTR (cg10891888)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.35E-02; Z-score:6.84E-01

Methylation in Case

1.45E-01 (Median) Methylation in Control 1.35E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

TSS1500 (cg20408693)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:8.14E-05; Z-score:-8.25E-01

Methylation in Case

4.29E-02 (Median) Methylation in Control 6.61E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

TSS1500 (cg26212328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:2.89E-03; Z-score:5.63E-01

Methylation in Case

1.18E-01 (Median) Methylation in Control 8.75E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

TSS1500 (cg07688749)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:8.96E-03; Z-score:7.98E-01

Methylation in Case

8.99E-02 (Median) Methylation in Control 7.86E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

TSS1500 (cg19620086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.04E-02; Z-score:-9.34E-01

Methylation in Case

8.64E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

TSS1500 (cg06864895)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.46E-02; Z-score:7.34E-01

Methylation in Case

4.45E-01 (Median) Methylation in Control 3.65E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

TSS200 (cg10002103)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.02E-02; Z-score:8.73E-01

Methylation in Case

5.20E-02 (Median) Methylation in Control 4.45E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

Body (cg09050775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:4.24E-03; Z-score:7.51E-01

Methylation in Case

7.81E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC38A2 in colorectal cancer [ 3 ]

Location

3'UTR (cg23334507)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.38E-03; Z-score:7.39E-01

Methylation in Case

9.11E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

5'UTR (cg13580008)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.64E+00 Statistic Test p-value:2.81E-13; Z-score:2.35E+00

Methylation in Case

5.15E-01 (Median) Methylation in Control 3.14E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

5'UTR (cg12464898)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:7.76E-12; Z-score:-3.36E+00

Methylation in Case

6.24E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg27435138)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:1.25E-19; Z-score:-5.96E+00

Methylation in Case

4.66E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg16848712)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:1.99E-04; Z-score:1.21E+00

Methylation in Case

3.25E-01 (Median) Methylation in Control 2.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg26212328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.83E+00 Statistic Test p-value:7.63E-04; Z-score:1.14E+00

Methylation in Case

2.35E-01 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg06864895)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:4.20E-03; Z-score:1.17E+00

Methylation in Case

3.69E-01 (Median) Methylation in Control 2.54E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg19620086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.89E-02; Z-score:-8.15E-01

Methylation in Case

6.07E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg20408693)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.34E-02; Z-score:-2.17E-02

Methylation in Case

4.61E-02 (Median) Methylation in Control 4.63E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

Body (cg18666630)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:1.32E-14; Z-score:-2.76E+00

Methylation in Case

2.75E-01 (Median) Methylation in Control 4.05E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC38A2 in hepatocellular carcinoma [ 4 ]

Location

Body (cg17319718)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:1.29E-12; Z-score:-3.79E+00

Methylation in Case

7.40E-01 (Median) Methylation in Control 9.56E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

5'UTR (cg09973502)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.64E-02; Z-score:-2.73E-01

Methylation in Case

6.31E-02 (Median) Methylation in Control 6.59E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

TSS1500 (cg21563683)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.73E+00 Statistic Test p-value:3.40E-08; Z-score:3.33E+00

Methylation in Case

3.21E-01 (Median) Methylation in Control 1.85E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

TSS1500 (cg19620086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:9.81E-08; Z-score:2.19E+00

Methylation in Case

7.49E-01 (Median) Methylation in Control 6.53E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

TSS1500 (cg26212328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.75E+00 Statistic Test p-value:8.08E-07; Z-score:1.31E+00

Methylation in Case

4.14E-02 (Median) Methylation in Control 2.37E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

TSS1500 (cg27491190)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.80E-06; Z-score:1.98E+00

Methylation in Case

4.87E-01 (Median) Methylation in Control 4.00E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

TSS1500 (cg06864895)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:6.53E-03; Z-score:9.69E-01

Methylation in Case

1.02E-01 (Median) Methylation in Control 7.95E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

TSS1500 (cg20408693)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:7.89E-03; Z-score:1.13E+00

Methylation in Case

3.84E-02 (Median) Methylation in Control 2.84E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

TSS1500 (cg07688749)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.76E-02; Z-score:-5.05E-01

Methylation in Case

5.59E-02 (Median) Methylation in Control 6.10E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC38A2 in HIV infection [ 5 ]

Location

Body (cg09050775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:1.82E-04; Z-score:-1.81E+00

Methylation in Case

5.61E-01 (Median) Methylation in Control 6.94E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

5'UTR (cg10891888)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.61E-02; Z-score:6.71E-01

Methylation in Case

8.82E-02 (Median) Methylation in Control 8.08E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

5'UTR (cg13591723)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.35E-02; Z-score:3.26E-01

Methylation in Case

3.65E-02 (Median) Methylation in Control 3.47E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

5'UTR (cg09973502)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:4.29E-02; Z-score:2.20E-01

Methylation in Case

4.48E-02 (Median) Methylation in Control 4.36E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg20408693)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.51E+00 Statistic Test p-value:1.24E-05; Z-score:-1.12E+00

Methylation in Case

9.46E-02 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg19620086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:8.57E-03; Z-score:4.47E-01

Methylation in Case

9.11E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A2 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg16848712)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.49E-02; Z-score:7.69E-01

Methylation in Case

6.03E-01 (Median) Methylation in Control 5.62E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in systemic lupus erythematosus [ 7 ]

Location

5'UTR (cg10891888)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.03E-02; Z-score:-3.00E-02

Methylation in Case

1.33E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in systemic lupus erythematosus [ 7 ]

Location

TSS1500 (cg26212328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:6.23E-03; Z-score:2.58E-01

Methylation in Case

3.79E-02 (Median) Methylation in Control 3.47E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in systemic lupus erythematosus [ 7 ]

Location

Body (cg20830447)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:8.42E-03; Z-score:-1.03E-02

Methylation in Case

6.75E-02 (Median) Methylation in Control 6.77E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

TSS1500 (cg27491190)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.70E+00 Statistic Test p-value:1.13E-04; Z-score:-4.53E+00

Methylation in Case

3.73E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

TSS1500 (cg19620086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:3.82E-04; Z-score:-4.08E+00

Methylation in Case

4.89E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

TSS1500 (cg20408693)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:3.99E-04; Z-score:-2.49E+00

Methylation in Case

4.67E-02 (Median) Methylation in Control 5.86E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

TSS1500 (cg21563683)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.02E+00 Statistic Test p-value:1.32E-03; Z-score:-3.25E+00

Methylation in Case

2.31E-01 (Median) Methylation in Control 4.66E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

TSS1500 (cg06864895)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.49E+00 Statistic Test p-value:1.23E-02; Z-score:-2.27E+00

Methylation in Case

1.02E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

TSS1500 (cg16848712)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:3.90E-02; Z-score:-1.43E+00

Methylation in Case

1.85E-01 (Median) Methylation in Control 2.85E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC38A2 in bladder cancer [ 8 ]

Location

Body (cg09050775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-4.09E+00 Statistic Test p-value:1.08E-04; Z-score:-4.72E+00

Methylation in Case

1.25E-01 (Median) Methylation in Control 5.13E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in breast cancer [ 9 ]

Location

TSS1500 (cg16848712)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:5.46E-03; Z-score:-8.56E-01

Methylation in Case

5.43E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in breast cancer [ 9 ]

Location

TSS1500 (cg27491190)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:9.85E-03; Z-score:-9.57E-01

Methylation in Case

6.20E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in breast cancer [ 9 ]

Location

TSS1500 (cg06864895)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:3.21E-02; Z-score:-7.25E-01

Methylation in Case

5.95E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in breast cancer [ 9 ]

Location

TSS1500 (cg26212328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.74E-02; Z-score:-4.94E-01

Methylation in Case

5.25E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in breast cancer [ 9 ]

Location

TSS200 (cg15333818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.86E-02; Z-score:1.09E-01

Methylation in Case

5.49E-02 (Median) Methylation in Control 5.30E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A2 in breast cancer [ 9 ]

Location

Body (cg09050775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:2.00E-05; Z-score:1.09E+00

Methylation in Case

4.90E-01 (Median) Methylation in Control 4.26E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Celiac disease

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in celiac disease [ 10 ]

Location

TSS1500 (cg26212328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:1.49E-02; Z-score:8.58E-01

Methylation in Case

1.53E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

Celiac disease[ ICD-11:DA95]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in depression [ 11 ]

Location

TSS1500 (cg07688749)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.14E-02; Z-score:3.54E-01

Methylation in Case

5.39E-02 (Median) Methylation in Control 5.19E-02 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

TSS1500 (cg21563683)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:2.65E-03; Z-score:1.67E+00

Methylation in Case

5.31E-01 (Median) Methylation in Control 4.34E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

TSS1500 (cg19620086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.20E-02; Z-score:1.86E+00

Methylation in Case

8.11E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

TSS1500 (cg16848712)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:1.87E-02; Z-score:2.23E+00

Methylation in Case

3.74E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

TSS1500 (cg06864895)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.40E+00 Statistic Test p-value:2.20E-02; Z-score:1.62E+00

Methylation in Case

4.61E-01 (Median) Methylation in Control 3.28E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in lung adenocarcinoma [ 12 ]

Location

TSS1500 (cg26212328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.56E+00 Statistic Test p-value:2.77E-02; Z-score:2.36E+00

Methylation in Case

2.73E-01 (Median) Methylation in Control 1.74E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

TSS200 (cg18069290)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.34E-02; Z-score:6.96E-01

Methylation in Case

4.42E-01 (Median) Methylation in Control 4.13E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

Body (cg11634297)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.72E-08; Z-score:-1.41E+00

Methylation in Case

6.28E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

Body (cg05169846)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.70E+00 Statistic Test p-value:9.75E-04; Z-score:-1.12E+00

Methylation in Case

1.19E-01 (Median) Methylation in Control 2.02E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

Body (cg01421830)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:2.02E-03; Z-score:1.10E+00

Methylation in Case

6.43E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

Body (cg26529851)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.34E-02; Z-score:9.22E-01

Methylation in Case

6.51E-01 (Median) Methylation in Control 5.54E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC38A2 in pancretic ductal adenocarcinoma [ 13 ]

Location

3'UTR (ch.13.268523R)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:5.67E-03; Z-score:-4.54E-01

Methylation in Case

3.55E-02 (Median) Methylation in Control 5.31E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Colon cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in colon adenocarcinoma [ 14 ]

Location

1stExon (cg05962092)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:9.24E-07; Z-score:1.93E+00

Methylation in Case

7.40E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in colon adenocarcinoma [ 14 ]

Location

1stExon (cg00056676)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:2.39E-03; Z-score:1.76E+00

Methylation in Case

1.32E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC38A2 in colon adenocarcinoma [ 14 ]

Location

Body (cg01266985)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.83E-05; Z-score:2.19E+00

Methylation in Case

7.55E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC38A2 in panic disorder [ 15 ]

Location

Body (cg09050775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:5.36E-01 Statistic Test p-value:3.09E-03; Z-score:5.92E-01

Methylation in Case

-2.33E-01 (Median) Methylation in Control -4.35E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC38A2 in panic disorder [ 15 ]

Location

3'UTR (cg23334507)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:3.89E-02; Z-score:-4.17E-01

Methylation in Case

3.09E-01 (Median) Methylation in Control 4.95E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Early gestation women

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC38A2 in early gestation women [ 17 ]

Location

Enchancer (cg10354880)

Epigenetic Type

Methylation Experiment Method HumanMethylation450 BeadChip

Studied Phenotype

Early gestation women

Experimental Material

Patient tissue samples

Additional Notes

SLC38A2 had increased methylation in pancreatic gestation.

Histone acetylation

  Activated amino acid response signaling pathways

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hyperacetylation of SLC38A2 in activated amino acid response signaling pathways (compare with unfolded protein response signaling pathways) [ 16 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofSLC38A2 Experiment Method RT-qPCR

Studied Phenotype

Activated amino acid response signaling pathways

Experimental Material

Human hepatocellular carcinoma cell line (HepG2)

Additional Notes

Hyperacetylation of histone H3 and recruitment of the general transcription factors at the HepG2 SLC38A2 promoter occurred in response to the activated amino acid but not the unfolded protein.

microRNA

  Unclear Phenotype

         73 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

let-7b directly targets SLC38A2 [ 18 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

let-7e directly targets SLC38A2 [ 19 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-101 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-101 miRNA Mature ID miR-101-3p

miRNA Sequence

UACAGUACUGUGAUAACUGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-124 directly targets SLC38A2 [ 21 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon5

miR-1245b directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1245b miRNA Mature ID miR-1245b-3p

miRNA Sequence

UCAGAUGAUCUAAAGGCCUAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1269a directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1269a miRNA Mature ID miR-1269a

miRNA Sequence

CUGGACUGAGCCGUGCUACUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-1269b directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1269b miRNA Mature ID miR-1269b

miRNA Sequence

CUGGACUGAGCCAUGCUACUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-1288 directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1288 miRNA Mature ID miR-1288-3p

miRNA Sequence

UGGACUGCCCUGAUCUGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-1296 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1296 miRNA Mature ID miR-1296-3p

miRNA Sequence

GAGUGGGGCUUCGACCCUAACC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-130a directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-130a miRNA Mature ID miR-130a-3p

miRNA Sequence

CAGUGCAAUGUUAAAAGGGCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-130b directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-130b miRNA Mature ID miR-130b-3p

miRNA Sequence

CAGUGCAAUGAUGAAAGGGCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

miR-132 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-132 miRNA Mature ID miR-132-3p

miRNA Sequence

UAACAGUCUACAGCCAUGGUCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-142 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-142 miRNA Mature ID miR-142-5p

miRNA Sequence

CAUAAAGUAGAAAGCACUACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

miR-148a directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-148a miRNA Mature ID miR-148a-3p

miRNA Sequence

UCAGUGCACUACAGAACUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

miR-148b directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-148b miRNA Mature ID miR-148b-3p

miRNA Sequence

UCAGUGCAUCACAGAACUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-152 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-152 miRNA Mature ID miR-152-3p

miRNA Sequence

UCAGUGCAUGACAGAACUUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-16 directly targets SLC38A2 [ 18 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon18

miR-181a directly targets SLC38A2 [ 23 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181a miRNA Mature ID miR-181a-5p

miRNA Sequence

AACAUUCAACGCUGUCGGUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-181b directly targets SLC38A2 [ 23 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181b miRNA Mature ID miR-181b-5p

miRNA Sequence

AACAUUCAUUGCUGUCGGUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-181c directly targets SLC38A2 [ 23 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181c miRNA Mature ID miR-181c-5p

miRNA Sequence

AACAUUCAACCUGUCGGUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-181d directly targets SLC38A2 [ 23 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181d miRNA Mature ID miR-181d-5p

miRNA Sequence

AACAUUCAUUGUUGUCGGUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-1825 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1825 miRNA Mature ID miR-1825

miRNA Sequence

UCCAGUGCCCUCCUCUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon23

miR-18a directly targets SLC38A2 [ 19 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-18a miRNA Mature ID miR-18a-3p

miRNA Sequence

ACUGCCCUAAGUGCUCCUUCUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

miR-193b directly targets SLC38A2 [ 19 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

miR-194 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-194 miRNA Mature ID miR-194-3p

miRNA Sequence

CCAGUGGGGCUGCUGUUAUCUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

miR-199a directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-199a miRNA Mature ID miR-199a-5p

miRNA Sequence

CCCAGUGUUCAGACUACCUGUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-199b directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-199b miRNA Mature ID miR-199b-5p

miRNA Sequence

CCCAGUGUUUAGACUAUCUGUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-19a directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-19b directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-212 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-212 miRNA Mature ID miR-212-3p

miRNA Sequence

UAACAGUCUCCAGUCACGGCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon31

miR-2355 directly targets SLC38A2 [ 24 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-2355 miRNA Mature ID miR-2355-3p

miRNA Sequence

AUUGUCCUUGCUGUUUGGAGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

miR-26a directly targets SLC38A2 [ 23 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-26a miRNA Mature ID miR-26a-5p

miRNA Sequence

UUCAAGUAAUCCAGGAUAGGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-26b directly targets SLC38A2 [ 23 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-301a directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-301a miRNA Mature ID miR-301a-3p

miRNA Sequence

CAGUGCAAUAGUAUUGUCAAAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon35

miR-301b directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-301b miRNA Mature ID miR-301b-3p

miRNA Sequence

CAGUGCAAUGAUAUUGUCAAAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon36

miR-30a directly targets SLC38A2 [ 18 ]

Epigenetic Type

microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon37

miR-3145 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3145 miRNA Mature ID miR-3145-3p

miRNA Sequence

AGAUAUUUUGAGUGUUUGGAAUUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

miR-3161 directly targets SLC38A2 [ 24 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3161 miRNA Mature ID miR-3161

miRNA Sequence

CUGAUAAGAACAGAGGCCCAGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

miR-320b directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-320b miRNA Mature ID miR-320b

miRNA Sequence

AAAAGCUGGGUUGAGAGGGCAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

miR-320c directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-320c miRNA Mature ID miR-320c

miRNA Sequence

AAAAGCUGGGUUGAGAGGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-320d directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-320d miRNA Mature ID miR-320d

miRNA Sequence

AAAAGCUGGGUUGAGAGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

miR-335 directly targets SLC38A2 [ 25 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-340 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon44

miR-3666 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3666 miRNA Mature ID miR-3666

miRNA Sequence

CAGUGCAAGUGUAGAUGCCGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon45

miR-3912 directly targets SLC38A2 [ 24 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3912 miRNA Mature ID miR-3912-5p

miRNA Sequence

AUGUCCAUAUUAUGGGUUAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

miR-4295 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4295 miRNA Mature ID miR-4295

miRNA Sequence

CAGUGCAAUGUUUUCCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-4429 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4429 miRNA Mature ID miR-4429

miRNA Sequence

AAAAGCUGGGCUGAGAGGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon48

miR-4450 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4450 miRNA Mature ID miR-4450

miRNA Sequence

UGGGGAUUUGGAGAAGUGGUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon49

miR-4474 directly targets SLC38A2 [ 24 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4474 miRNA Mature ID miR-4474-3p

miRNA Sequence

UUGUGGCUGGUCAUGAGGCUAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon50

miR-4515 directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4515 miRNA Mature ID miR-4515

miRNA Sequence

AGGACUGGACUCCCGGCAGCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-454 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-454 miRNA Mature ID miR-454-3p

miRNA Sequence

UAGUGCAAUAUUGCUUAUAGGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon52

miR-455 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon53

miR-4642 directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4642 miRNA Mature ID miR-4642

miRNA Sequence

AUGGCAUCGUCCCCUGGUGGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon54

miR-4646 directly targets SLC38A2 [ 24 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4646 miRNA Mature ID miR-4646-3p

miRNA Sequence

AUUGUCCCUCUCCCUUCCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon55

miR-4682 directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4682 miRNA Mature ID miR-4682

miRNA Sequence

UCUGAGUUCCUGGAGCCUGGUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-4699 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4699 miRNA Mature ID miR-4699-3p

miRNA Sequence

AAUUUACUCUGCAAUCUUCUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon57

miR-4704 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4704 miRNA Mature ID miR-4704-5p

miRNA Sequence

GACACUAGGCAUGUGAGUGAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon58

miR-4711 directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4711 miRNA Mature ID miR-4711-5p

miRNA Sequence

UGCAUCAGGCCAGAAGACAUGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-4731 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4731 miRNA Mature ID miR-4731-3p

miRNA Sequence

CACACAAGUGGCCCCCAACACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon60

miR-4740 directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4740 miRNA Mature ID miR-4740-5p

miRNA Sequence

AGGACUGAUCCUCUCGGGCAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-4757 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4757 miRNA Mature ID miR-4757-5p

miRNA Sequence

AGGCCUCUGUGACGUCACGGUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon62

miR-4789 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4789 miRNA Mature ID miR-4789-5p

miRNA Sequence

GUAUACACCUGAUAUGUGUAUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon63

miR-4801 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4801 miRNA Mature ID miR-4801

miRNA Sequence

UACACAAGAAAACCAAGGCUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon64

miR-491 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-491 miRNA Mature ID miR-491-5p

miRNA Sequence

AGUGGGGAACCCUUCCAUGAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon65

miR-548at directly targets SLC38A2 [ 24 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548at miRNA Mature ID miR-548at-5p

miRNA Sequence

AAAAGUUAUUGCGGUUUUGGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon66

miR-5590 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5590 miRNA Mature ID miR-5590-3p

miRNA Sequence

AAUAAAGUUCAUGUAUGGCAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon67

miR-599 directly targets SLC38A2 [ 24 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-599 miRNA Mature ID miR-599

miRNA Sequence

GUUGUGUCAGUUUAUCAAAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon68

miR-6744 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6744 miRNA Mature ID miR-6744-3p

miRNA Sequence

GGGCCUCUCUUGUCAUCCUGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon69

miR-6857 directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6857 miRNA Mature ID miR-6857-3p

miRNA Sequence

UGACUGAGCUUCUCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon70

miR-6857 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6857 miRNA Mature ID miR-6857-5p

miRNA Sequence

UUGGGGAUUGGGUCAGGCCAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon71

miR-6878 directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6878 miRNA Mature ID miR-6878-3p

miRNA Sequence

CUGGCCUCUUCUUUCUCCUAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon72

miR-8081 directly targets SLC38A2 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8081 miRNA Mature ID miR-8081

miRNA Sequence

CUUGAGUCGUGCCUUUCUGAAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon73

miR-9-3p directly targets SLC38A2 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-9-3p miRNA Mature ID miR-9-3p

miRNA Sequence

AUAAAGCUAGAUAACCGAAAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 DNA Methylation Dynamics in Urological Tumors.
9 Genome-wide Scan for Methylation Profiles in Breast Cancer
10 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
11 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
14 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16 Despite increased ATF4 binding at the C/EBP-ATF composite site following activation of the unfolded protein response, system A transporter 2 (SNAT2) transcription activity is repressed in HepG2 cells. J Biol Chem. 2008 Oct 10;283(41):27736-47.
17 Early gestation as the critical time-window for changes in the prenatal environment to affect the adult human blood methylome. Int J Epidemiol. 2015 Aug;44(4):1211-23.
18 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
19 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
20 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
21 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
22 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
23 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
24 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
25 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.