Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0326 Transporter Info | ||||
Gene Name | SLC38A1 | ||||
Transporter Name | Sodium-coupled neutral amino acid transporter 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
70 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
let-7b directly targets SLC38A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-5p | ||
miRNA Sequence |
UGAGGUAGUAGGUUGUGUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon2 |
miR-1277 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1277 | miRNA Mature ID | miR-1277-5p | ||
miRNA Sequence |
AAAUAUAUAUAUAUAUGUACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-1293 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1293 | miRNA Mature ID | miR-1293 | ||
miRNA Sequence |
UGGGUGGUCUGGAGAUUUGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-136 directly targets SLC38A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-136 | miRNA Mature ID | miR-136-5p | ||
miRNA Sequence |
ACUCCAUUUGUUUUGAUGAUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon5 |
miR-142 directly targets SLC38A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-142 | miRNA Mature ID | miR-142-5p | ||
miRNA Sequence |
CAUAAAGUAGAAAGCACUACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-16 directly targets SLC38A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | pSILAC//Proteomics;Other | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon7 |
miR-185 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-5p | ||
miRNA Sequence |
UGGAGAGAAAGGCAGUUCCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-205 directly targets SLC38A1 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-205 | miRNA Mature ID | miR-205-5p | ||
miRNA Sequence |
UCCUUCAUUCCACCGGAGUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon9 |
miR-2113 directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-2113 | miRNA Mature ID | miR-2113 | ||
miRNA Sequence |
AUUUGUGCUUGGCUCUGUCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon10 |
miR-215 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-215 | miRNA Mature ID | miR-215-3p | ||
miRNA Sequence |
UCUGUCAUUUCUUUAGGCCAAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon11 |
miR-218 directly targets SLC38A1 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-218 | miRNA Mature ID | miR-218-5p | ||
miRNA Sequence |
UUGUGCUUGAUCUAACCAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon12 |
miR-30a directly targets SLC38A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | pSILAC//Proteomics;Other | ||
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-5p | ||
miRNA Sequence |
UGUAAACAUCCUCGACUGGAAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon13 |
miR-31 directly targets SLC38A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-31 | miRNA Mature ID | miR-31-3p | ||
miRNA Sequence |
UGCUAUGCCAACAUAUUGCCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon14 |
miR-3148 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3148 | miRNA Mature ID | miR-3148 | ||
miRNA Sequence |
UGGAAAAAACUGGUGUGUGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon15 |
miR-320d directly targets SLC38A1 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-320d | miRNA Mature ID | miR-320d | ||
miRNA Sequence |
AAAAGCUGGGUUGAGAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon16 |
miR-329 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-329 | miRNA Mature ID | miR-329-5p | ||
miRNA Sequence |
GAGGUUUUCUGGGUUUCUGUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon17 |
miR-335 directly targets SLC38A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-3p | ||
miRNA Sequence |
UUUUUCAUUAUUGCUCCUGACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon18 |
miR-340 directly targets SLC38A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-340 | miRNA Mature ID | miR-340-5p | ||
miRNA Sequence |
UUAUAAAGCAAUGAGACUGAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon19 |
miR-363 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-363 | miRNA Mature ID | miR-363-5p | ||
miRNA Sequence |
CGGGUGGAUCACGAUGCAAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon20 |
miR-3671 directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3671 | miRNA Mature ID | miR-3671 | ||
miRNA Sequence |
AUCAAAUAAGGACUAGUCUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon21 |
miR-3679 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3679 | miRNA Mature ID | miR-3679-3p | ||
miRNA Sequence |
CUUCCCCCCAGUAAUCUUCAUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon22 |
miR-3688 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3688 | miRNA Mature ID | miR-3688-3p | ||
miRNA Sequence |
UAUGGAAAGACUUUGCCACUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon23 |
miR-369 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-369 | miRNA Mature ID | miR-369-3p | ||
miRNA Sequence |
AAUAAUACAUGGUUGAUCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon24 |
miR-374a directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-374a | miRNA Mature ID | miR-374a-5p | ||
miRNA Sequence |
UUAUAAUACAACCUGAUAAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon25 |
miR-374b directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-374b | miRNA Mature ID | miR-374b-5p | ||
miRNA Sequence |
AUAUAAUACAACCUGCUAAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon26 |
miR-4306 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4306 | miRNA Mature ID | miR-4306 | ||
miRNA Sequence |
UGGAGAGAAAGGCAGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon27 |
miR-4317 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4317 | miRNA Mature ID | miR-4317 | ||
miRNA Sequence |
ACAUUGCCAGGGAGUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon28 |
miR-4446 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4446 | miRNA Mature ID | miR-4446-5p | ||
miRNA Sequence |
AUUUCCCUGCCAUUCCCUUGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon29 |
miR-4457 directly targets SLC38A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4457 | miRNA Mature ID | miR-4457 | ||
miRNA Sequence |
UCACAAGGUAUUGACUGGCGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon30 |
miR-4483 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4483 | miRNA Mature ID | miR-4483 | ||
miRNA Sequence |
GGGGUGGUCUGUUGUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon31 |
miR-4517 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4517 | miRNA Mature ID | miR-4517 | ||
miRNA Sequence |
AAAUAUGAUGAAACUCACAGCUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon32 |
miR-4639 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4639 | miRNA Mature ID | miR-4639-5p | ||
miRNA Sequence |
UUGCUAAGUAGGCUGAGAUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon33 |
miR-4644 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4644 | miRNA Mature ID | miR-4644 | ||
miRNA Sequence |
UGGAGAGAGAAAAGAGACAGAAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon34 |
miR-4652 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4652 | miRNA Mature ID | miR-4652-3p | ||
miRNA Sequence |
GUUCUGUUAACCCAUCCCCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon35 |
miR-4716 directly targets SLC38A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4716 | miRNA Mature ID | miR-4716-5p | ||
miRNA Sequence |
UCCAUGUUUCCUUCCCCCUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon36 |
miR-4726 directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4726 | miRNA Mature ID | miR-4726-3p | ||
miRNA Sequence |
ACCCAGGUUCCCUCUGGCCGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon37 |
miR-4743 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4743 | miRNA Mature ID | miR-4743-3p | ||
miRNA Sequence |
UUUCUGUCUUUUCUGGUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon38 |
miR-484 directly targets SLC38A1 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-484 | miRNA Mature ID | miR-484 | ||
miRNA Sequence |
UCAGGCUCAGUCCCCUCCCGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon39 |
miR-506 directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-506 | miRNA Mature ID | miR-506-5p | ||
miRNA Sequence |
UAUUCAGGAAGGUGUUACUUAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon40 |
miR-513b directly targets SLC38A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-513b | miRNA Mature ID | miR-513b-5p | ||
miRNA Sequence |
UUCACAAGGAGGUGUCAUUUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon41 |
miR-5192 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5192 | miRNA Mature ID | miR-5192 | ||
miRNA Sequence |
AGGAGAGUGGAUUCCAGGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon42 |
miR-548ag directly targets SLC38A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ag | miRNA Mature ID | miR-548ag | ||
miRNA Sequence |
AAAGGUAAUUGUGGUUUCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon43 |
miR-548ai directly targets SLC38A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ai | miRNA Mature ID | miR-548ai | ||
miRNA Sequence |
AAAGGUAAUUGCAGUUUUUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon44 |
miR-548ba directly targets SLC38A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ba | miRNA Mature ID | miR-548ba | ||
miRNA Sequence |
AAAGGUAACUGUGAUUUUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon45 |
miR-548m directly targets SLC38A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548m | miRNA Mature ID | miR-548m | ||
miRNA Sequence |
CAAAGGUAUUUGUGGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon46 |
miR-5583 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5583 | miRNA Mature ID | miR-5583-3p | ||
miRNA Sequence |
GAAUAUGGGUAUAUUAGUUUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon47 |
miR-5590 directly targets SLC38A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5590 | miRNA Mature ID | miR-5590-3p | ||
miRNA Sequence |
AAUAAAGUUCAUGUAUGGCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon48 |
miR-5692b directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5692b | miRNA Mature ID | miR-5692b | ||
miRNA Sequence |
AAUAAUAUCACAGUAGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon49 |
miR-5692c directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5692c | miRNA Mature ID | miR-5692c | ||
miRNA Sequence |
AAUAAUAUCACAGUAGGUGUAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon50 |
miR-570 directly targets SLC38A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-570 | miRNA Mature ID | miR-570-5p | ||
miRNA Sequence |
AAAGGUAAUUGCAGUUUUUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon51 |
miR-570 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-570 | miRNA Mature ID | miR-570-3p | ||
miRNA Sequence |
CGAAAACAGCAAUUACCUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon52 |
miR-578 directly targets SLC38A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-578 | miRNA Mature ID | miR-578 | ||
miRNA Sequence |
CUUCUUGUGCUCUAGGAUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon53 |
miR-607 directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-607 | miRNA Mature ID | miR-607 | ||
miRNA Sequence |
GUUCAAAUCCAGAUCUAUAAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon54 |
miR-6074 directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6074 | miRNA Mature ID | miR-6074 | ||
miRNA Sequence |
GAUAUUCAGAGGCUAGGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon55 |
miR-6124 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6124 | miRNA Mature ID | miR-6124 | ||
miRNA Sequence |
GGGAAAAGGAAGGGGGAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon56 |
miR-6745 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6745 | miRNA Mature ID | miR-6745 | ||
miRNA Sequence |
UGGGUGGAAGAAGGUCUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon57 |
miR-6748 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6748 | miRNA Mature ID | miR-6748-5p | ||
miRNA Sequence |
UGUGGGUGGGAAGGACUGGAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon58 |
miR-6756 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6756 | miRNA Mature ID | miR-6756-5p | ||
miRNA Sequence |
AGGGUGGGGCUGGAGGUGGGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon59 |
miR-6766 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6766 | miRNA Mature ID | miR-6766-5p | ||
miRNA Sequence |
CGGGUGGGAGCAGAUCUUAUUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon60 |
miR-6773 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6773 | miRNA Mature ID | miR-6773-3p | ||
miRNA Sequence |
ACUGUCACUUCUCUGCCCAUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon61 |
miR-6804 directly targets SLC38A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6804 | miRNA Mature ID | miR-6804-5p | ||
miRNA Sequence |
UGAGGGUGUCAGCAGGUGACG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon62 |
miR-6832 directly targets SLC38A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6832 | miRNA Mature ID | miR-6832-3p | ||
miRNA Sequence |
ACCCUUUUUCUCUUUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon63 |
miR-6847 directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6847 | miRNA Mature ID | miR-6847-3p | ||
miRNA Sequence |
GGCUCAUGUGUCUGUCCUCUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon64 |
miR-6868 directly targets SLC38A1 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6868 | miRNA Mature ID | miR-6868-3p | ||
miRNA Sequence |
UUCCUUCUGUUGUCUGUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon65 |
miR-6880 directly targets SLC38A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6880 | miRNA Mature ID | miR-6880-5p | ||
miRNA Sequence |
UGGUGGAGGAAGAGGGCAGCUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon66 |
miR-6888 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6888 | miRNA Mature ID | miR-6888-3p | ||
miRNA Sequence |
AUCUGUCUCGAUUGUUUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon67 |
miR-8076 directly targets SLC38A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-8076 | miRNA Mature ID | miR-8076 | ||
miRNA Sequence |
UAUAUGGACUUUUCUGAUACAAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon68 |
miR-877 directly targets SLC38A1 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-877 | miRNA Mature ID | miR-877-3p | ||
miRNA Sequence |
UCCUCUUCUCCCUCCUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon69 |
miR-889 directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-889 | miRNA Mature ID | miR-889-3p | ||
miRNA Sequence |
UUAAUAUCGGACAACCAUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon70 |
miR-892c directly targets SLC38A1 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-892c | miRNA Mature ID | miR-892c-5p | ||
miRNA Sequence |
UAUUCAGAAAGGUGCCAGUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.