Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0324 Transporter Info | ||||
| Gene Name | SLC37A3 | ||||
| Transporter Name | Sugar phosphate exchanger 3 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1250 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1250 | miRNA Mature ID | miR-1250-3p | ||
|
miRNA Sequence |
ACAUUUUCCAGCCCAUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
miR-1305 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1305 | miRNA Mature ID | miR-1305 | ||
|
miRNA Sequence |
UUUUCAACUCUAAUGGGAGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-136 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-136 | miRNA Mature ID | miR-136-5p | ||
|
miRNA Sequence |
ACUCCAUUUGUUUUGAUGAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-142 directly targets SLC37A3 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-142 | miRNA Mature ID | miR-142-3p | ||
|
miRNA Sequence |
UGUAGUGUUUCCUACUUUAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-181a directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-181a | miRNA Mature ID | miR-181a-5p | ||
|
miRNA Sequence |
AACAUUCAACGCUGUCGGUGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon6 |
miR-3123 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3123 | miRNA Mature ID | miR-3123 | ||
|
miRNA Sequence |
CAGAGAAUUGUUUAAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon7 |
miR-32 directly targets SLC37A3 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-32 | miRNA Mature ID | miR-32-5p | ||
|
miRNA Sequence |
UAUUGCACAUUACUAAGUUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-3922 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3922 | miRNA Mature ID | miR-3922-5p | ||
|
miRNA Sequence |
UCAAGGCCAGAGGUCCCACAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-3925 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3925 | miRNA Mature ID | miR-3925-5p | ||
|
miRNA Sequence |
AAGAGAACUGAAAGUGGAGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon10 |
miR-483 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-483 | miRNA Mature ID | miR-483-3p | ||
|
miRNA Sequence |
UCACUCCUCUCCUCCCGUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon11 |
miR-561 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-561 | miRNA Mature ID | miR-561-5p | ||
|
miRNA Sequence |
AUCAAGGAUCUUAAACUUUGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon12 |
miR-6794 directly targets SLC37A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6794 | miRNA Mature ID | miR-6794-3p | ||
|
miRNA Sequence |
CUCACUCUCAGUCCCUCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon13 |
miR-92a directly targets SLC37A3 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
|
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-92b directly targets SLC37A3 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-3p | ||
|
miRNA Sequence |
UAUUGCACUCGUCCCGGCCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.