Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0322 Transporter Info
Gene Name	SLC37A1
Transporter Name	Glycerol-3-phosphate permease
Gene ID	54020
UniProt ID	P57057

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	20 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg00549412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:5.33E-09; Z-score:1.54E+00
Methylation in Case	7.56E-01 (Median)	Methylation in Control	5.63E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg01879556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:1.18E-08; Z-score:1.93E+00
Methylation in Case	8.52E-01 (Median)	Methylation in Control	6.34E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg06579790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.51E+00	Statistic Test	p-value:6.48E-08; Z-score:-1.42E+00
Methylation in Case	3.27E-01 (Median)	Methylation in Control	4.93E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg09546172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.90E+00	Statistic Test	p-value:1.85E-07; Z-score:-1.86E+00
Methylation in Case	1.55E-01 (Median)	Methylation in Control	2.95E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg12993026)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:4.23E-07; Z-score:-1.29E+00
Methylation in Case	8.10E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg17398613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:1.93E-06; Z-score:-1.34E+00
Methylation in Case	3.21E-01 (Median)	Methylation in Control	4.23E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg22599036)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:6.35E-06; Z-score:7.76E-01
Methylation in Case	8.09E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg23336810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:7.03E-06; Z-score:1.34E+00
Methylation in Case	8.62E-01 (Median)	Methylation in Control	6.83E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg00288945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:1.99E-05; Z-score:-1.08E+00
Methylation in Case	5.69E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04096368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:5.55E-04; Z-score:-9.61E-01
Methylation in Case	6.69E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04192258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.93E+00	Statistic Test	p-value:5.99E-04; Z-score:-8.37E-01
Methylation in Case	1.26E-01 (Median)	Methylation in Control	2.42E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg08193480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:5.60E-03; Z-score:2.81E-01
Methylation in Case	1.88E-02 (Median)	Methylation in Control	1.77E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg08407901)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:6.16E-03; Z-score:-9.02E-01
Methylation in Case	5.36E-01 (Median)	Methylation in Control	6.57E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg08529312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:7.23E-03; Z-score:6.31E-02
Methylation in Case	8.50E-02 (Median)	Methylation in Control	8.38E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg11453546)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.25E-02; Z-score:-4.95E-01
Methylation in Case	9.58E-01 (Median)	Methylation in Control	9.67E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg12409874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:2.76E-02; Z-score:3.37E-01
Methylation in Case	3.37E-01 (Median)	Methylation in Control	3.14E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg12913778)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:3.17E-02; Z-score:5.11E-01
Methylation in Case	5.29E-01 (Median)	Methylation in Control	4.55E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon18	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg13128052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:3.29E-02; Z-score:5.14E-01
Methylation in Case	8.81E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon19	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg13960334)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:4.02E-02; Z-score:-2.01E-01
Methylation in Case	1.57E-01 (Median)	Methylation in Control	1.80E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon20	Methylation of SLC37A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg24141725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:1.21E-09; Z-score:-1.49E+00
Methylation in Case	4.89E-01 (Median)	Methylation in Control	6.45E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg23336810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.41E+00	Statistic Test	p-value:3.00E-08; Z-score:-7.60E+00
Methylation in Case	2.97E-01 (Median)	Methylation in Control	7.14E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg00549412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.55E+00	Statistic Test	p-value:7.23E-06; Z-score:-5.05E+00
Methylation in Case	4.21E-01 (Median)	Methylation in Control	6.53E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg09546172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:1.28E-05; Z-score:-3.65E+00
Methylation in Case	1.00E-01 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg08599496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:5.37E-06; Z-score:-4.54E+00
Methylation in Case	7.05E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg17218342)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:1.90E-04; Z-score:-3.78E+00
Methylation in Case	7.22E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg13265003)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:3.90E-03; Z-score:-2.07E+00
Methylation in Case	5.89E-01 (Median)	Methylation in Control	6.52E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	Body (cg04096368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:1.54E-07; Z-score:-6.03E+00
Methylation in Case	5.24E-01 (Median)	Methylation in Control	6.93E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	Body (cg12409874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:3.52E-05; Z-score:-4.91E+00
Methylation in Case	7.13E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	Body (cg18478353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:3.52E-03; Z-score:4.04E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	6.76E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	Body (cg08193480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:7.55E-03; Z-score:-1.02E+00
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	Body (cg08529312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.69E-02; Z-score:-6.18E-01
Methylation in Case	8.00E-01 (Median)	Methylation in Control	8.09E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC37A1 in bladder cancer			[ 2 ]
Location	Body (cg00288945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.14E-02; Z-score:-1.27E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	5'UTR (cg17398613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.70E-09; Z-score:1.02E+00
Methylation in Case	7.53E-01 (Median)	Methylation in Control	7.04E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	5'UTR (cg23336810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:2.89E-06; Z-score:-1.22E+00
Methylation in Case	5.50E-01 (Median)	Methylation in Control	6.55E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	5'UTR (cg09546172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.39E+00	Statistic Test	p-value:4.50E-06; Z-score:-1.10E+00
Methylation in Case	9.30E-02 (Median)	Methylation in Control	1.29E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg13265003)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:3.15E-06; Z-score:-6.75E-01
Methylation in Case	6.74E-01 (Median)	Methylation in Control	7.04E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg17218342)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.36E-05; Z-score:-1.20E+00
Methylation in Case	7.55E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg08599496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:2.28E-02; Z-score:-8.74E-01
Methylation in Case	6.64E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	TSS200 (cg20002045)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:4.59E-02; Z-score:1.12E+00
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg04096368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:9.92E-09; Z-score:-1.69E+00
Methylation in Case	5.75E-01 (Median)	Methylation in Control	6.55E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg18478353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.41E-08; Z-score:1.17E+00
Methylation in Case	7.23E-01 (Median)	Methylation in Control	6.76E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg13960334)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:2.98E-06; Z-score:9.40E-01
Methylation in Case	9.54E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg08529312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.03E-05; Z-score:9.00E-01
Methylation in Case	7.86E-01 (Median)	Methylation in Control	7.20E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg12409874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.58E-04; Z-score:-7.28E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg13128052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.12E-03; Z-score:-6.30E-01
Methylation in Case	8.18E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg08193480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:2.45E-02; Z-score:4.64E-01
Methylation in Case	7.86E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg12913778)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:2.81E-02; Z-score:5.43E-01
Methylation in Case	5.06E-01 (Median)	Methylation in Control	4.79E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	Body (cg00288945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.86E-02; Z-score:-2.12E-01
Methylation in Case	8.41E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC37A1 in breast cancer			[ 3 ]
Location	3'UTR (cg24141725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:5.79E-03; Z-score:-4.14E-01
Methylation in Case	9.25E-01 (Median)	Methylation in Control	9.31E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg09546172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:4.50E-09; Z-score:-1.36E+00
Methylation in Case	5.91E-02 (Median)	Methylation in Control	8.88E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg23336810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:5.62E-04; Z-score:-2.38E+00
Methylation in Case	6.86E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg22599036)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:2.22E-02; Z-score:4.36E-01
Methylation in Case	2.13E-02 (Median)	Methylation in Control	1.94E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg08193480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:5.13E-03; Z-score:-1.05E+00
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	5'UTR (cg00549412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:2.03E-04; Z-score:-1.03E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	5'UTR (cg06579790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.29E+00	Statistic Test	p-value:4.55E-03; Z-score:-5.25E-01
Methylation in Case	2.60E-02 (Median)	Methylation in Control	3.35E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	5'UTR (cg17398613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.51E-02; Z-score:-3.27E-01
Methylation in Case	8.98E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg08599496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.12E-08; Z-score:-2.10E+00
Methylation in Case	8.92E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg13265003)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:3.63E-05; Z-score:-1.15E+00
Methylation in Case	7.89E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	TSS200 (cg20002045)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:4.77E-02; Z-score:-1.52E-01
Methylation in Case	9.35E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	Body (cg08529312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.53E-05; Z-score:-9.78E-01
Methylation in Case	9.05E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	Body (cg08193480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:8.91E-04; Z-score:-6.57E-01
Methylation in Case	9.35E-01 (Median)	Methylation in Control	9.40E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	Body (cg11453546)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.29E-03; Z-score:-8.77E-01
Methylation in Case	6.59E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	Body (cg04192258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.51E-03; Z-score:-1.46E-01
Methylation in Case	9.68E-01 (Median)	Methylation in Control	9.69E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	Body (cg13960334)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.18E-02; Z-score:-5.60E-01
Methylation in Case	9.64E-01 (Median)	Methylation in Control	9.69E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC37A1 in colorectal cancer			[ 5 ]
Location	Body (cg18478353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.46E-02; Z-score:-2.41E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg23336810)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.59E-03; Z-score:9.06E-01
Methylation in Case	8.30E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg08599496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:8.19E-07; Z-score:-1.47E+00
Methylation in Case	7.98E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg17218342)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.34E-02; Z-score:-2.79E-01
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg13730736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.71E+00	Statistic Test	p-value:2.71E-19; Z-score:-3.83E+00
Methylation in Case	2.96E-01 (Median)	Methylation in Control	5.07E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg08033262)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.67E+00	Statistic Test	p-value:1.13E-18; Z-score:-9.23E+00
Methylation in Case	5.02E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg13960334)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.59E-05; Z-score:9.05E-01
Methylation in Case	9.61E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg12409874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.86E-05; Z-score:-1.35E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg12913778)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:3.02E-05; Z-score:2.54E+00
Methylation in Case	6.37E-01 (Median)	Methylation in Control	5.65E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg04096368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.96E-04; Z-score:-3.69E-01
Methylation in Case	7.94E-01 (Median)	Methylation in Control	8.08E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg18478353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.95E-03; Z-score:-5.54E-01
Methylation in Case	7.15E-01 (Median)	Methylation in Control	7.31E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg00288945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.00E-03; Z-score:-5.45E-01
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg11453546)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.12E-02; Z-score:5.77E-01
Methylation in Case	7.16E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg08193480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.56E-02; Z-score:4.79E-01
Methylation in Case	8.52E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg04192258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.85E-02; Z-score:-4.29E-01
Methylation in Case	9.62E-01 (Median)	Methylation in Control	9.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC37A1 in hepatocellular carcinoma			[ 6 ]
Location	3'UTR (cg24141725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.25E-02; Z-score:-4.50E-01
Methylation in Case	9.09E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	5'UTR (cg00549412)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.32E-12; Z-score:1.45E+00
Methylation in Case	7.80E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	5'UTR (cg17398613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:4.91E-12; Z-score:1.56E+00
Methylation in Case	8.52E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	TSS1500 (cg13265003)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.48E+00	Statistic Test	p-value:2.83E-17; Z-score:5.44E+00
Methylation in Case	8.23E-01 (Median)	Methylation in Control	5.55E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	Body (cg18478353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.29E-05; Z-score:7.23E-01
Methylation in Case	8.04E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	Body (cg00288945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.71E-03; Z-score:-1.09E+00
Methylation in Case	9.09E-01 (Median)	Methylation in Control	9.47E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	Body (cg12913778)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.73E-03; Z-score:6.52E-01
Methylation in Case	6.73E-01 (Median)	Methylation in Control	6.46E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	Body (cg04096368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.75E-03; Z-score:-1.38E+00
Methylation in Case	8.20E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	Body (cg13128052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:5.53E-03; Z-score:-6.34E-01
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC37A1 in HIV infection			[ 7 ]
Location	Body (cg08529312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:6.17E-03; Z-score:-7.43E-01
Methylation in Case	8.61E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg17398613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:2.86E-03; Z-score:1.68E+00
Methylation in Case	7.87E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg01879556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:3.32E-03; Z-score:-1.52E+00
Methylation in Case	7.36E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	5'UTR (cg17398613)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:1.16E-08; Z-score:1.36E+00
Methylation in Case	7.71E-01 (Median)	Methylation in Control	6.93E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	5'UTR (cg09546172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:4.46E-02; Z-score:-5.46E-01
Methylation in Case	1.04E-01 (Median)	Methylation in Control	1.12E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg17218342)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.61E-04; Z-score:-7.74E-01
Methylation in Case	7.54E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg12409874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:7.03E-09; Z-score:-2.45E+00
Methylation in Case	8.61E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg13128052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.81E-05; Z-score:-1.19E+00
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg18478353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:7.53E-05; Z-score:1.24E+00
Methylation in Case	7.98E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg08193480)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.51E-04; Z-score:-8.41E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg08529312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.43E-04; Z-score:-5.63E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg13960334)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.32E-03; Z-score:-6.81E-01
Methylation in Case	9.35E-01 (Median)	Methylation in Control	9.45E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC37A1 in papillary thyroid cancer			[ 9 ]
Location	Body (cg04096368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:3.75E-02; Z-score:-7.88E-01
Methylation in Case	3.69E-01 (Median)	Methylation in Control	4.19E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in systemic lupus erythematosus			[ 10 ]
Location	5'UTR (cg01879556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.41E-03; Z-score:-7.18E-02
Methylation in Case	7.75E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in systemic lupus erythematosus			[ 10 ]
Location	TSS1500 (cg08599496)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.16E-02; Z-score:-1.39E-01
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg11453546)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.97E-02; Z-score:-1.44E-01
Methylation in Case	5.48E-01 (Median)	Methylation in Control	5.56E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in systemic lupus erythematosus			[ 10 ]
Location	Body (cg04192258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.92E-02; Z-score:-1.43E-01
Methylation in Case	9.55E-01 (Median)	Methylation in Control	9.57E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg17816637)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:1.99E-11; Z-score:-2.09E+00
Methylation in Case	4.13E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg14777768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-3.26E+00	Statistic Test	p-value:2.72E-11; Z-score:-2.46E+00
Methylation in Case	1.12E-01 (Median)	Methylation in Control	3.65E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg14153919)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.38E-10; Z-score:1.99E+00
Methylation in Case	6.21E-01 (Median)	Methylation in Control	5.03E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg13491563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:2.09E-09; Z-score:-1.32E+00
Methylation in Case	5.83E-01 (Median)	Methylation in Control	6.42E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg22685369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:5.27E-09; Z-score:8.24E-01
Methylation in Case	5.24E-02 (Median)	Methylation in Control	4.17E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg04395689)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.14E+00	Statistic Test	p-value:1.70E-06; Z-score:1.65E+00
Methylation in Case	3.97E-01 (Median)	Methylation in Control	1.86E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	TSS1500 (cg04433322)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:1.05E-03; Z-score:-1.06E+00
Methylation in Case	5.40E-01 (Median)	Methylation in Control	6.34E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg18865990)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:1.77E-11; Z-score:-1.96E+00
Methylation in Case	3.79E-01 (Median)	Methylation in Control	5.31E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg08894629)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.39E+00	Statistic Test	p-value:2.15E-04; Z-score:-8.12E-01
Methylation in Case	9.52E-02 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg15507500)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:8.02E-03; Z-score:1.13E+00
Methylation in Case	9.28E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg09050775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.19E+00	Statistic Test	p-value:8.70E-03; Z-score:8.40E-01
Methylation in Case	5.11E-01 (Median)	Methylation in Control	4.28E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg21821674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:1.12E-02; Z-score:6.66E-01
Methylation in Case	4.92E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg06660015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:1.14E-02; Z-score:-7.14E-01
Methylation in Case	2.47E-01 (Median)	Methylation in Control	2.94E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC37A1 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg15999077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.24E-02; Z-score:-4.81E-01
Methylation in Case	5.07E-01 (Median)	Methylation in Control	5.37E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in prostate cancer			[ 12 ]
Location	TSS1500 (cg15930596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:4.01E-02; Z-score:6.00E+00
Methylation in Case	1.40E-01 (Median)	Methylation in Control	9.36E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in prostate cancer			[ 12 ]
Location	TSS1500 (cg22685369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:4.74E-02; Z-score:-3.96E+00
Methylation in Case	3.00E-02 (Median)	Methylation in Control	4.04E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in prostate cancer			[ 12 ]
Location	Body (cg06903325)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.57E-02; Z-score:1.29E+00
Methylation in Case	9.60E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in colon adenocarcinoma			[ 13 ]
Location	Body (cg13551505)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:1.12E-07; Z-score:-3.44E+00
Methylation in Case	3.96E-01 (Median)	Methylation in Control	5.70E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in colon adenocarcinoma			[ 13 ]
Location	Body (cg01082559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.26E-04; Z-score:-2.45E+00
Methylation in Case	7.65E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC37A1 in colon adenocarcinoma			[ 13 ]
Location	Body (cg08581937)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.05E+00	Statistic Test	p-value:8.16E-04; Z-score:3.57E+00
Methylation in Case	2.15E-01 (Median)	Methylation in Control	7.06E-02 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC37A1 in colon adenocarcinoma			[ 13 ]
Location	Body (cg24944109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:3.29E-03; Z-score:1.32E+00
Methylation in Case	3.09E-01 (Median)	Methylation in Control	2.34E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC37A1 in panic disorder			[ 14 ]
Location	Body (cg12409874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.68E-03; Z-score:6.03E-01
Methylation in Case	2.79E+00 (Median)	Methylation in Control	2.62E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC37A1 in panic disorder			[ 14 ]
Location	Body (cg08529312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:2.07E-02; Z-score:5.71E-01
Methylation in Case	2.80E+00 (Median)	Methylation in Control	2.60E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC37A1 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.007416241; Fold-change:0.236321798; Z-score:1.528412788
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC37A1 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.00189494; Fold-change:0.259010689; Z-score:1.485990013
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC37A1 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:2.87E-09; Fold-change:0.211924252; Z-score:1.398096231
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC37A1 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:2.24E-11; Fold-change:0.277512459; Z-score:2.351163478
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC37A1 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:8.75E-20; Fold-change:0.207985187; Z-score:1.519737076
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chronic myelogenous leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC37A1 in chronic myelogenous leukaemia than that in healthy individual
Studied Phenotype	Chronic myelogenous leukemia [ICD-11:2A20.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.014111374; Fold-change:-0.299646286; Z-score:-1.346764594
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC37A1 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:6.71E-20; Fold-change:-0.365086283; Z-score:-2.690029482
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-19a directly targets SLC37A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-19a	miRNA Mature ID	miR-19a-3p
miRNA Sequence	UGUGCAAAUCUAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-19b directly targets SLC37A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-19b	miRNA Mature ID	miR-19b-3p
miRNA Sequence	UGUGCAAAUCCAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-335 directly targets SLC37A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
15	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
16	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence