Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0321 Transporter Info | ||||
Gene Name | SLC36A4 | ||||
Transporter Name | Proton-coupled amino acid transporter 4 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Renal cell carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in clear cell renal cell carcinoma | [ 1 ] | |||
Location |
TSS1500 (cg11354057) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:6.36E-05; Z-score:5.94E-01 | ||
Methylation in Case |
2.72E-02 (Median) | Methylation in Control | 2.48E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in clear cell renal cell carcinoma | [ 1 ] | |||
Location |
TSS1500 (cg12518360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:2.73E-03; Z-score:7.90E-01 | ||
Methylation in Case |
3.18E-02 (Median) | Methylation in Control | 2.81E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in clear cell renal cell carcinoma | [ 1 ] | |||
Location |
1stExon (cg19791003) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.29E-02; Z-score:6.21E-01 | ||
Methylation in Case |
2.28E-02 (Median) | Methylation in Control | 2.13E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in colorectal cancer | [ 2 ] | |||
Location |
TSS1500 (cg26553710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.22E-02; Z-score:-4.11E-01 | ||
Methylation in Case |
8.75E-02 (Median) | Methylation in Control | 9.28E-02 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in colorectal cancer | [ 2 ] | |||
Location |
TSS200 (cg15554438) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.69E-02; Z-score:-8.44E-01 | ||
Methylation in Case |
1.79E-01 (Median) | Methylation in Control | 1.98E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in colorectal cancer | [ 2 ] | |||
Location |
Body (cg26445561) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:6.50E-06; Z-score:-1.50E+00 | ||
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC36A4 in colorectal cancer | [ 2 ] | |||
Location |
Body (cg09303150) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:6.87E-05; Z-score:-1.10E+00 | ||
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in hepatocellular carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg26553710) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:6.37E-04; Z-score:2.86E-01 | ||
Methylation in Case |
5.38E-02 (Median) | Methylation in Control | 5.12E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in hepatocellular carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg26131803) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.47E-03; Z-score:-6.30E-02 | ||
Methylation in Case |
6.76E-02 (Median) | Methylation in Control | 6.83E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in hepatocellular carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg12518360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:8.08E-03; Z-score:3.72E-01 | ||
Methylation in Case |
8.61E-02 (Median) | Methylation in Control | 7.97E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC36A4 in hepatocellular carcinoma | [ 3 ] | |||
Location |
TSS200 (cg15554438) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:3.19E-02; Z-score:4.06E-01 | ||
Methylation in Case |
9.79E-02 (Median) | Methylation in Control | 9.05E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC36A4 in hepatocellular carcinoma | [ 3 ] | |||
Location |
1stExon (cg19791003) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.70E-02; Z-score:1.73E-01 | ||
Methylation in Case |
3.35E-02 (Median) | Methylation in Control | 3.08E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC36A4 in hepatocellular carcinoma | [ 3 ] | |||
Location |
Body (cg00965391) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.50E-02; Z-score:-9.29E-02 | ||
Methylation in Case |
3.52E-02 (Median) | Methylation in Control | 3.58E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in HIV infection | [ 4 ] | |||
Location |
TSS1500 (cg26131803) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:2.83E-02; Z-score:6.11E-01 | ||
Methylation in Case |
6.06E-02 (Median) | Methylation in Control | 5.29E-02 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in HIV infection | [ 4 ] | |||
Location |
TSS1500 (cg12518360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:4.00E-02; Z-score:-4.14E-01 | ||
Methylation in Case |
7.17E-02 (Median) | Methylation in Control | 7.72E-02 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in HIV infection | [ 4 ] | |||
Location |
Body (cg26445561) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.42E+00 | Statistic Test | p-value:2.94E-21; Z-score:3.11E+00 | ||
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC36A4 in HIV infection | [ 4 ] | |||
Location |
Body (cg09303150) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:6.14E-12; Z-score:1.99E+00 | ||
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 6.96E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
TSS1500 (cg12074493) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.47E+00 | Statistic Test | p-value:9.16E-04; Z-score:-7.13E-01 | ||
Methylation in Case |
9.88E-02 (Median) | Methylation in Control | 1.45E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
TSS1500 (cg09621438) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:9.32E-03; Z-score:-6.53E-01 | ||
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 1.62E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in pancretic ductal adenocarcinoma | [ 5 ] | |||
Location |
Body (cg16933967) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.40E-02; Z-score:-1.81E-01 | ||
Methylation in Case |
4.36E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS1500 (cg26131803) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.23E-02; Z-score:-9.07E-01 | ||
Methylation in Case |
6.24E-02 (Median) | Methylation in Control | 7.20E-02 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in papillary thyroid cancer | [ 6 ] | |||
Location |
Body (cg26445561) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:8.56E-06; Z-score:-1.20E+00 | ||
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in papillary thyroid cancer | [ 6 ] | |||
Location |
3'UTR (cg12119032) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:8.20E-04; Z-score:8.57E-01 | ||
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in systemic lupus erythematosus | [ 7 ] | |||
Location |
TSS1500 (cg12518360) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.82E-02; Z-score:-1.09E-01 | ||
Methylation in Case |
9.46E-02 (Median) | Methylation in Control | 9.68E-02 (Median) | ||
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Colon cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in colon adenocarcinoma | [ 8 ] | |||
Location |
TSS200 (cg17381377) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.35E+00 | Statistic Test | p-value:2.00E-03; Z-score:1.43E+00 | ||
Methylation in Case |
2.80E-01 (Median) | Methylation in Control | 2.08E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in colon adenocarcinoma | [ 8 ] | |||
Location |
1stExon (cg04874129) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:2.48E-05; Z-score:1.89E+00 | ||
Methylation in Case |
5.03E-01 (Median) | Methylation in Control | 3.88E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in colon adenocarcinoma | [ 8 ] | |||
Location |
Body (cg02457319) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:4.40E-04; Z-score:-8.44E-01 | ||
Methylation in Case |
3.16E-01 (Median) | Methylation in Control | 3.80E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in atypical teratoid rhabdoid tumor | [ 9 ] | |||
Location |
1stExon (cg19791003) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.36E+00 | Statistic Test | p-value:2.79E-17; Z-score:2.96E+00 | ||
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 5.94E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in atypical teratoid rhabdoid tumor | [ 9 ] | |||
Location |
Body (cg00965391) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.42E-05; Z-score:-7.87E-01 | ||
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in atypical teratoid rhabdoid tumor | [ 9 ] | |||
Location |
Body (cg09303150) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:9.87E-03; Z-score:5.42E-01 | ||
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC36A4 in atypical teratoid rhabdoid tumor | [ 9 ] | |||
Location |
Body (cg11879480) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:2.54E-02; Z-score:3.38E-01 | ||
Methylation in Case |
5.43E-02 (Median) | Methylation in Control | 4.80E-02 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC36A4 in atypical teratoid rhabdoid tumor | [ 9 ] | |||
Location |
Body (cg11926764) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:2.58E-02; Z-score:8.28E-01 | ||
Methylation in Case |
6.14E-01 (Median) | Methylation in Control | 5.18E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC36A4 in atypical teratoid rhabdoid tumor | [ 9 ] | |||
Location |
3'UTR (cg12119032) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.18E-11; Z-score:1.95E+00 | ||
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in bladder cancer | [ 10 ] | |||
Location |
Body (cg09303150) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:7.20E-05; Z-score:-2.51E+00 | ||
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in breast cancer | [ 11 ] | |||
Location |
Body (cg26445561) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.56E-02; Z-score:-5.50E-01 | ||
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.24E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in breast cancer | [ 11 ] | |||
Location |
Body (cg11879480) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:3.25E-02; Z-score:3.71E-01 | ||
Methylation in Case |
1.08E-01 (Median) | Methylation in Control | 9.90E-02 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC36A4 in breast cancer | [ 11 ] | |||
Location |
3'UTR (cg12119032) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.13E-03; Z-score:-4.22E-01 | ||
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC36A4 in panic disorder | [ 12 ] | |||
Location |
Body (cg09303150) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.60E+00 | Statistic Test | p-value:1.96E-02; Z-score:-3.14E-01 | ||
Methylation in Case |
1.53E-01 (Median) | Methylation in Control | 2.45E-01 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC36A4 in panic disorder | [ 12 ] | |||
Location |
3'UTR (cg12119032) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:9.01E-04; Z-score:-7.05E-01 | ||
Methylation in Case |
4.62E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-203b directly targets SLC36A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-203b | miRNA Mature ID | miR-203b-3p | ||
miRNA Sequence |
UUGAACUGUUAAGAACCACUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-300 directly targets SLC36A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-300 | miRNA Mature ID | miR-300 | ||
miRNA Sequence |
UAUACAAGGGCAGACUCUCUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-3613 directly targets SLC36A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3613 | miRNA Mature ID | miR-3613-3p | ||
miRNA Sequence |
ACAAAAAAAAAAGCCCAACCCUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-381 directly targets SLC36A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-381 | miRNA Mature ID | miR-381-3p | ||
miRNA Sequence |
UAUACAAGGGCAAGCUCUCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon5 |
miR-487a directly targets SLC36A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-487a | miRNA Mature ID | miR-487a-5p | ||
miRNA Sequence |
GUGGUUAUCCCUGCUGUGUUCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-487b directly targets SLC36A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-487b | miRNA Mature ID | miR-487b-5p | ||
miRNA Sequence |
GUGGUUAUCCCUGUCCUGUUCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon7 |
miR-548p directly targets SLC36A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548p | miRNA Mature ID | miR-548p | ||
miRNA Sequence |
UAGCAAAAACUGCAGUUACUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-7158 directly targets SLC36A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7158 | miRNA Mature ID | miR-7158-3p | ||
miRNA Sequence |
CUGAACUAGAGAUUGGGCCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.