General Information of Drug Transporter (DT)
DT ID DTD0321 Transporter Info
Gene Name SLC36A4
Transporter Name Proton-coupled amino acid transporter 4
Gene ID
120103
UniProt ID
Q6YBV0
Epigenetic Regulations of This DT (EGR)

Methylation

  Renal cell carcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in clear cell renal cell carcinoma [ 1 ]

Location

TSS1500 (cg11354057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:6.36E-05; Z-score:5.94E-01

Methylation in Case

2.72E-02 (Median) Methylation in Control 2.48E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in clear cell renal cell carcinoma [ 1 ]

Location

TSS1500 (cg12518360)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:2.73E-03; Z-score:7.90E-01

Methylation in Case

3.18E-02 (Median) Methylation in Control 2.81E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in clear cell renal cell carcinoma [ 1 ]

Location

1stExon (cg19791003)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.29E-02; Z-score:6.21E-01

Methylation in Case

2.28E-02 (Median) Methylation in Control 2.13E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in colorectal cancer [ 2 ]

Location

TSS1500 (cg26553710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.22E-02; Z-score:-4.11E-01

Methylation in Case

8.75E-02 (Median) Methylation in Control 9.28E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in colorectal cancer [ 2 ]

Location

TSS200 (cg15554438)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.69E-02; Z-score:-8.44E-01

Methylation in Case

1.79E-01 (Median) Methylation in Control 1.98E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in colorectal cancer [ 2 ]

Location

Body (cg26445561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:6.50E-06; Z-score:-1.50E+00

Methylation in Case

8.99E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC36A4 in colorectal cancer [ 2 ]

Location

Body (cg09303150)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:6.87E-05; Z-score:-1.10E+00

Methylation in Case

9.28E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg26553710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:6.37E-04; Z-score:2.86E-01

Methylation in Case

5.38E-02 (Median) Methylation in Control 5.12E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg26131803)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.47E-03; Z-score:-6.30E-02

Methylation in Case

6.76E-02 (Median) Methylation in Control 6.83E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg12518360)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:8.08E-03; Z-score:3.72E-01

Methylation in Case

8.61E-02 (Median) Methylation in Control 7.97E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC36A4 in hepatocellular carcinoma [ 3 ]

Location

TSS200 (cg15554438)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:3.19E-02; Z-score:4.06E-01

Methylation in Case

9.79E-02 (Median) Methylation in Control 9.05E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC36A4 in hepatocellular carcinoma [ 3 ]

Location

1stExon (cg19791003)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.70E-02; Z-score:1.73E-01

Methylation in Case

3.35E-02 (Median) Methylation in Control 3.08E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC36A4 in hepatocellular carcinoma [ 3 ]

Location

Body (cg00965391)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.50E-02; Z-score:-9.29E-02

Methylation in Case

3.52E-02 (Median) Methylation in Control 3.58E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in HIV infection [ 4 ]

Location

TSS1500 (cg26131803)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:2.83E-02; Z-score:6.11E-01

Methylation in Case

6.06E-02 (Median) Methylation in Control 5.29E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in HIV infection [ 4 ]

Location

TSS1500 (cg12518360)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:4.00E-02; Z-score:-4.14E-01

Methylation in Case

7.17E-02 (Median) Methylation in Control 7.72E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in HIV infection [ 4 ]

Location

Body (cg26445561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.42E+00 Statistic Test p-value:2.94E-21; Z-score:3.11E+00

Methylation in Case

8.46E-01 (Median) Methylation in Control 5.97E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC36A4 in HIV infection [ 4 ]

Location

Body (cg09303150)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:6.14E-12; Z-score:1.99E+00

Methylation in Case

7.95E-01 (Median) Methylation in Control 6.96E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in pancretic ductal adenocarcinoma [ 5 ]

Location

TSS1500 (cg12074493)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:9.16E-04; Z-score:-7.13E-01

Methylation in Case

9.88E-02 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in pancretic ductal adenocarcinoma [ 5 ]

Location

TSS1500 (cg09621438)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:9.32E-03; Z-score:-6.53E-01

Methylation in Case

1.33E-01 (Median) Methylation in Control 1.62E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in pancretic ductal adenocarcinoma [ 5 ]

Location

Body (cg16933967)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.40E-02; Z-score:-1.81E-01

Methylation in Case

4.36E-01 (Median) Methylation in Control 4.42E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg26131803)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.23E-02; Z-score:-9.07E-01

Methylation in Case

6.24E-02 (Median) Methylation in Control 7.20E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in papillary thyroid cancer [ 6 ]

Location

Body (cg26445561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.56E-06; Z-score:-1.20E+00

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in papillary thyroid cancer [ 6 ]

Location

3'UTR (cg12119032)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:8.20E-04; Z-score:8.57E-01

Methylation in Case

8.76E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in systemic lupus erythematosus [ 7 ]

Location

TSS1500 (cg12518360)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.82E-02; Z-score:-1.09E-01

Methylation in Case

9.46E-02 (Median) Methylation in Control 9.68E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Colon cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in colon adenocarcinoma [ 8 ]

Location

TSS200 (cg17381377)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:2.00E-03; Z-score:1.43E+00

Methylation in Case

2.80E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in colon adenocarcinoma [ 8 ]

Location

1stExon (cg04874129)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:2.48E-05; Z-score:1.89E+00

Methylation in Case

5.03E-01 (Median) Methylation in Control 3.88E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in colon adenocarcinoma [ 8 ]

Location

Body (cg02457319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:4.40E-04; Z-score:-8.44E-01

Methylation in Case

3.16E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in atypical teratoid rhabdoid tumor [ 9 ]

Location

1stExon (cg19791003)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:2.79E-17; Z-score:2.96E+00

Methylation in Case

8.08E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in atypical teratoid rhabdoid tumor [ 9 ]

Location

Body (cg00965391)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.42E-05; Z-score:-7.87E-01

Methylation in Case

8.26E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in atypical teratoid rhabdoid tumor [ 9 ]

Location

Body (cg09303150)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:9.87E-03; Z-score:5.42E-01

Methylation in Case

6.63E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC36A4 in atypical teratoid rhabdoid tumor [ 9 ]

Location

Body (cg11879480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:2.54E-02; Z-score:3.38E-01

Methylation in Case

5.43E-02 (Median) Methylation in Control 4.80E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC36A4 in atypical teratoid rhabdoid tumor [ 9 ]

Location

Body (cg11926764)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:2.58E-02; Z-score:8.28E-01

Methylation in Case

6.14E-01 (Median) Methylation in Control 5.18E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC36A4 in atypical teratoid rhabdoid tumor [ 9 ]

Location

3'UTR (cg12119032)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.18E-11; Z-score:1.95E+00

Methylation in Case

9.01E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in bladder cancer [ 10 ]

Location

Body (cg09303150)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:7.20E-05; Z-score:-2.51E+00

Methylation in Case

7.97E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in breast cancer [ 11 ]

Location

Body (cg26445561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.56E-02; Z-score:-5.50E-01

Methylation in Case

7.84E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in breast cancer [ 11 ]

Location

Body (cg11879480)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:3.25E-02; Z-score:3.71E-01

Methylation in Case

1.08E-01 (Median) Methylation in Control 9.90E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC36A4 in breast cancer [ 11 ]

Location

3'UTR (cg12119032)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:5.13E-03; Z-score:-4.22E-01

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC36A4 in panic disorder [ 12 ]

Location

Body (cg09303150)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:1.96E-02; Z-score:-3.14E-01

Methylation in Case

1.53E-01 (Median) Methylation in Control 2.45E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC36A4 in panic disorder [ 12 ]

Location

3'UTR (cg12119032)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.49E+00 Statistic Test p-value:9.01E-04; Z-score:-7.05E-01

Methylation in Case

4.62E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-203b directly targets SLC36A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-203b miRNA Mature ID miR-203b-3p

miRNA Sequence

UUGAACUGUUAAGAACCACUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-300 directly targets SLC36A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-300 miRNA Mature ID miR-300

miRNA Sequence

UAUACAAGGGCAGACUCUCUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-3613 directly targets SLC36A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3613 miRNA Mature ID miR-3613-3p

miRNA Sequence

ACAAAAAAAAAAGCCCAACCCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-381 directly targets SLC36A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-381 miRNA Mature ID miR-381-3p

miRNA Sequence

UAUACAAGGGCAAGCUCUCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-487a directly targets SLC36A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-487a miRNA Mature ID miR-487a-5p

miRNA Sequence

GUGGUUAUCCCUGCUGUGUUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-487b directly targets SLC36A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-487b miRNA Mature ID miR-487b-5p

miRNA Sequence

GUGGUUAUCCCUGUCCUGUUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-548p directly targets SLC36A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548p miRNA Mature ID miR-548p

miRNA Sequence

UAGCAAAAACUGCAGUUACUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-7158 directly targets SLC36A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7158 miRNA Mature ID miR-7158-3p

miRNA Sequence

CUGAACUAGAGAUUGGGCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
2 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
9 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
10 DNA Methylation Dynamics in Urological Tumors.
11 Genome-wide Scan for Methylation Profiles in Breast Cancer
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.