Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0305 Transporter Info
Gene Name	SLC35E4
Transporter Name	Solute carrier family 35 member E4
Gene ID	339665
UniProt ID	Q6ICL7

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in bladder cancer			[ 1 ]
Location	TSS1500 (cg06246950)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.06E+00	Statistic Test	p-value:9.92E-04; Z-score:-2.74E+00
Methylation in Case	2.21E-01 (Median)	Methylation in Control	4.57E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in bladder cancer			[ 1 ]
Location	TSS1500 (cg23072383)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.22E+00	Statistic Test	p-value:2.17E-03; Z-score:-3.12E+00
Methylation in Case	5.81E-02 (Median)	Methylation in Control	1.29E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in bladder cancer			[ 1 ]
Location	1stExon (cg26233253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.57E+00	Statistic Test	p-value:8.31E-06; Z-score:-4.23E+00
Methylation in Case	2.83E-01 (Median)	Methylation in Control	4.44E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC35E4 in bladder cancer			[ 1 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:5.99E-05; Z-score:7.16E+00
Methylation in Case	5.53E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC35E4 in bladder cancer			[ 1 ]
Location	Body (cg15648353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:9.14E-03; Z-score:-1.73E+00
Methylation in Case	5.69E-01 (Median)	Methylation in Control	6.02E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC35E4 in bladder cancer			[ 1 ]
Location	3'UTR (cg08622548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.51E-03; Z-score:-2.26E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in breast cancer			[ 2 ]
Location	TSS1500 (cg06246950)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:1.54E-02; Z-score:-7.79E-01
Methylation in Case	4.28E-01 (Median)	Methylation in Control	4.77E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in breast cancer			[ 2 ]
Location	1stExon (cg26233253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:6.84E-03; Z-score:6.72E-01
Methylation in Case	5.11E-01 (Median)	Methylation in Control	4.75E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in breast cancer			[ 2 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:4.03E-02; Z-score:-8.96E-01
Methylation in Case	5.09E-01 (Median)	Methylation in Control	5.68E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC35E4 in breast cancer			[ 2 ]
Location	Body (cg15648353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.51E-02; Z-score:-3.31E-01
Methylation in Case	5.57E-01 (Median)	Methylation in Control	5.96E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC35E4 in breast cancer			[ 2 ]
Location	3'UTR (cg08622548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.12E-02; Z-score:-6.00E-01
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg23072383)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-5.35E+00	Statistic Test	p-value:2.36E-11; Z-score:-3.05E+00
Methylation in Case	5.64E-02 (Median)	Methylation in Control	3.02E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg05610550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.59E-02; Z-score:8.01E-01
Methylation in Case	2.94E-02 (Median)	Methylation in Control	2.61E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg06246950)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:2.09E-04; Z-score:-1.01E+00
Methylation in Case	5.75E-01 (Median)	Methylation in Control	6.66E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg01217202)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.90E-03; Z-score:7.27E-01
Methylation in Case	7.41E-02 (Median)	Methylation in Control	6.82E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in colorectal cancer			[ 4 ]
Location	TSS200 (cg06330324)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.52E+00	Statistic Test	p-value:4.37E-05; Z-score:-8.39E-01
Methylation in Case	5.93E-02 (Median)	Methylation in Control	9.00E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC35E4 in colorectal cancer			[ 4 ]
Location	Body (cg15648353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:2.01E-14; Z-score:-2.29E+00
Methylation in Case	6.00E-01 (Median)	Methylation in Control	6.56E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg06246950)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:2.33E-02; Z-score:-4.86E-01
Methylation in Case	4.20E-01 (Median)	Methylation in Control	4.53E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in hepatocellular carcinoma			[ 5 ]
Location	TSS200 (cg13998988)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.37E+00	Statistic Test	p-value:3.50E-11; Z-score:-1.58E+00
Methylation in Case	5.15E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in hepatocellular carcinoma			[ 5 ]
Location	1stExon (cg26233253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.43E-02; Z-score:5.88E-01
Methylation in Case	7.44E-01 (Median)	Methylation in Control	7.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC35E4 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg23551873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.41E+00	Statistic Test	p-value:9.30E-16; Z-score:-9.43E+00
Methylation in Case	6.05E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC35E4 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.57E-03; Z-score:-6.21E-01
Methylation in Case	5.82E-01 (Median)	Methylation in Control	6.36E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC35E4 in hepatocellular carcinoma			[ 5 ]
Location	3'UTR (cg08622548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.59E-06; Z-score:-9.54E-01
Methylation in Case	8.31E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in lung adenocarcinoma			[ 6 ]
Location	TSS1500 (cg06246950)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:3.23E-02; Z-score:-1.11E+00
Methylation in Case	4.27E-01 (Median)	Methylation in Control	5.20E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg15648353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.88E-04; Z-score:-2.08E+00
Methylation in Case	6.19E-01 (Median)	Methylation in Control	6.42E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in lung adenocarcinoma			[ 6 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:8.49E-03; Z-score:-1.90E+00
Methylation in Case	6.40E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg14005240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.32E-02; Z-score:-3.92E-01
Methylation in Case	7.76E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg06864895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:2.18E-02; Z-score:-9.36E-01
Methylation in Case	4.88E-01 (Median)	Methylation in Control	6.44E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg01372572)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:4.44E-03; Z-score:9.72E-01
Methylation in Case	5.79E-01 (Median)	Methylation in Control	4.89E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC35E4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg01807748)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:1.85E-02; Z-score:4.32E-01
Methylation in Case	4.95E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC35E4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg13728439)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:3.45E-02; Z-score:7.62E-01
Methylation in Case	7.20E-01 (Median)	Methylation in Control	6.91E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC35E4 in pancretic ductal adenocarcinoma			[ 7 ]
Location	3'UTR (cg01634982)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:1.27E-03; Z-score:9.83E-01
Methylation in Case	6.77E-01 (Median)	Methylation in Control	5.89E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in papillary thyroid cancer			[ 8 ]
Location	TSS1500 (cg23072383)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-3.15E+00	Statistic Test	p-value:5.59E-25; Z-score:-3.49E+00
Methylation in Case	1.38E-01 (Median)	Methylation in Control	4.36E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in papillary thyroid cancer			[ 8 ]
Location	TSS200 (cg06330324)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.07E-02; Z-score:-3.79E-01
Methylation in Case	3.46E-02 (Median)	Methylation in Control	3.90E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in papillary thyroid cancer			[ 8 ]
Location	TSS200 (cg05610550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.93E-02; Z-score:-4.99E-01
Methylation in Case	7.48E-02 (Median)	Methylation in Control	8.24E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC35E4 in papillary thyroid cancer			[ 8 ]
Location	1stExon (cg26233253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:8.94E-03; Z-score:-9.65E-01
Methylation in Case	5.52E-01 (Median)	Methylation in Control	6.25E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in systemic lupus erythematosus			[ 9 ]
Location	TSS1500 (cg01217202)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.91E-03; Z-score:-2.33E-01
Methylation in Case	6.00E-02 (Median)	Methylation in Control	6.28E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in systemic lupus erythematosus			[ 9 ]
Location	TSS1500 (cg23072383)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:4.58E-02; Z-score:-3.01E-01
Methylation in Case	1.58E-01 (Median)	Methylation in Control	2.06E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in systemic lupus erythematosus			[ 9 ]
Location	TSS200 (cg05610550)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.29E-02; Z-score:-5.06E-02
Methylation in Case	7.38E-02 (Median)	Methylation in Control	7.49E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC35E4 in systemic lupus erythematosus			[ 9 ]
Location	Body (cg15648353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.31E-03; Z-score:-2.31E-01
Methylation in Case	5.79E-01 (Median)	Methylation in Control	5.87E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC35E4 in systemic lupus erythematosus			[ 9 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:3.16E-02; Z-score:-2.66E-01
Methylation in Case	6.32E-01 (Median)	Methylation in Control	6.92E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Panic disorder	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in panic disorder			[ 10 ]
Location	TSS200 (cg06330324)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:9.77E-01	Statistic Test	p-value:1.06E-02; Z-score:3.09E-01
Methylation in Case	-5.40E+00 (Median)	Methylation in Control	-5.53E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in panic disorder			[ 10 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.03E-02; Z-score:3.87E-01
Methylation in Case	2.34E+00 (Median)	Methylation in Control	2.15E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in panic disorder			[ 10 ]
Location	Body (cg15648353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:2.45E-02; Z-score:4.10E-01
Methylation in Case	1.03E+00 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	1stExon (cg26233253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:4.79E-16; Z-score:-2.29E+00
Methylation in Case	6.13E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:6.63E-03; Z-score:3.99E-01
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC35E4 in atypical teratoid rhabdoid tumor			[ 11 ]
Location	3'UTR (cg08622548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:5.46E-13; Z-score:-2.29E+00
Methylation in Case	7.59E-01 (Median)	Methylation in Control	9.10E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Colon cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in colon adenocarcinoma			[ 12 ]
Location	Body (cg14463790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.63E+00	Statistic Test	p-value:1.39E-08; Z-score:-4.49E+00
Methylation in Case	4.44E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in colon adenocarcinoma			[ 12 ]
Location	Body (cg05070518)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.43E+00	Statistic Test	p-value:3.72E-03; Z-score:1.90E+00
Methylation in Case	2.24E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in depression			[ 13 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.27E-02; Z-score:-6.12E-01
Methylation in Case	7.34E-01 (Median)	Methylation in Control	7.54E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
HIV infection	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC35E4 in HIV infection			[ 14 ]
Location	Body (cg08454563)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:5.70E-05; Z-score:-2.27E+00
Methylation in Case	6.97E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC35E4 in HIV infection			[ 14 ]
Location	3'UTR (cg08622548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:3.72E-02; Z-score:4.60E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	23 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1224 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1224	miRNA Mature ID	miR-1224-3p
miRNA Sequence	CCCCACCUCCUCUCUCCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-1245a directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1245a	miRNA Mature ID	miR-1245a
miRNA Sequence	AAGUGAUCUAAAGGCCUACAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-1260a directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1260a	miRNA Mature ID	miR-1260a
miRNA Sequence	AUCCCACCUCUGCCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-1260b directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1260b	miRNA Mature ID	miR-1260b
miRNA Sequence	AUCCCACCACUGCCACCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-138-2 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-138-2	miRNA Mature ID	miR-138-2-3p
miRNA Sequence	GCUAUUUCACGACACCAGGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-4437 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4437	miRNA Mature ID	miR-4437
miRNA Sequence	UGGGCUCAGGGUACAAAGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-4482 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4482	miRNA Mature ID	miR-4482-3p
miRNA Sequence	UUUCUAUUUCUCAGUGGGGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-4685 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4685	miRNA Mature ID	miR-4685-5p
miRNA Sequence	CCCAGGGCUUGGAGUGGGGCAAGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-4735 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4735	miRNA Mature ID	miR-4735-5p
miRNA Sequence	CCUAAUUUGAACACCUUCGGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-4775 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4775	miRNA Mature ID	miR-4775
miRNA Sequence	UUAAUUUUUUGUUUCGGUCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-5088 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5088	miRNA Mature ID	miR-5088-5p
miRNA Sequence	CAGGGCUCAGGGAUUGGAUGGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-532 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-532	miRNA Mature ID	miR-532-3p
miRNA Sequence	CCUCCCACACCCAAGGCUUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-590 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-590	miRNA Mature ID	miR-590-3p
miRNA Sequence	UAAUUUUAUGUAUAAGCUAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-6513 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6513	miRNA Mature ID	miR-6513-3p
miRNA Sequence	UCAAGUGUCAUCUGUCCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-6749 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6749	miRNA Mature ID	miR-6749-3p
miRNA Sequence	CUCCUCCCCUGCCUGGCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-6778 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6778	miRNA Mature ID	miR-6778-3p
miRNA Sequence	UGCCUCCCUGACAUUCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-6819 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6819	miRNA Mature ID	miR-6819-3p
miRNA Sequence	AAGCCUCUGUCCCCACCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-6837 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6837	miRNA Mature ID	miR-6837-5p
miRNA Sequence	ACCAGGGCCAGCAGGGAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-6872 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6872	miRNA Mature ID	miR-6872-3p
miRNA Sequence	CCCAUGCCUCCUGCCGCGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-6877 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6877	miRNA Mature ID	miR-6877-3p
miRNA Sequence	CAGCCUCUGCCCUUGGCCUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-7113 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7113	miRNA Mature ID	miR-7113-5p
miRNA Sequence	UCCAGGGAGACAGUGUGUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-7159 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7159	miRNA Mature ID	miR-7159-3p
miRNA Sequence	UUUCUAUGUUAGUUGGAAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-8079 directly targets SLC35E4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8079	miRNA Mature ID	miR-8079
miRNA Sequence	CAGUGAUCGUCUCUGCUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
13	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
14	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
15	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence