General Information of Drug Transporter (DT)
DT ID DTD0296 Transporter Info
Gene Name SLC35C1
Transporter Name GDP-fucose transporter 1
Gene ID
55343
UniProt ID
Q96A29
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

let-7a directly targets SLC35C1 [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

let-7a miRNA Mature ID let-7a-5p

miRNA Sequence

UGAGGUAGUAGGUUGUAUAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-26b directly targets SLC35C1 [ 2 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon3

miR-30a directly targets SLC35C1 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-30b directly targets SLC35C1 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30b miRNA Mature ID miR-30b-5p

miRNA Sequence

UGUAAACAUCCUACACUCAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-30c directly targets SLC35C1 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30c miRNA Mature ID miR-30c-5p

miRNA Sequence

UGUAAACAUCCUACACUCUCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-30d directly targets SLC35C1 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30d miRNA Mature ID miR-30d-5p

miRNA Sequence

UGUAAACAUCCCCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-30e directly targets SLC35C1 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30e miRNA Mature ID miR-30e-5p

miRNA Sequence

UGUAAACAUCCUUGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Glioblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC35C1 in glioblastoma than that in healthy individual

Studied Phenotype

Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.43E-15; Fold-change:-0.284522734; Z-score:-2.825048798
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC35C1 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.69E-14; Fold-change:-0.314413563; Z-score:-3.054203855
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Diffuse midline glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC35C1 in diffuse midline glioma than that in healthy individual

Studied Phenotype

Diffuse midline glioma [ICD-11:2A00.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.43E-42; Fold-change:-0.314504967; Z-score:-3.440294891
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Posterior fossa ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC35C1 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.18E-140; Fold-change:-0.381131538; Z-score:-4.335966359
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
2 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
3 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.