General Information of Drug Transporter (DT)
DT ID DTD0295 Transporter Info
Gene Name SLC35B4
Transporter Name UDP-xylose and UDP-N-acetylglucosamine transporter
Gene ID
84912
UniProt ID
Q969S0
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in colon adenocarcinoma [ 1 ]

Location

5'UTR (cg00019082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.16E-03; Z-score:-9.04E-01

Methylation in Case

8.78E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in colon adenocarcinoma [ 1 ]

Location

TSS1500 (cg06689659)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.80E-03; Z-score:-1.66E+00

Methylation in Case

7.66E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in colon adenocarcinoma [ 1 ]

Location

Body (cg01921066)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:2.15E-03; Z-score:-1.36E+00

Methylation in Case

2.39E-01 (Median) Methylation in Control 2.78E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Bladder cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in bladder cancer [ 2 ]

Location

TSS1500 (cg27581047)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.70E+00 Statistic Test p-value:7.78E-09; Z-score:-8.12E+00

Methylation in Case

5.86E-02 (Median) Methylation in Control 1.58E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in bladder cancer [ 2 ]

Location

TSS1500 (cg02820759)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.61E+00 Statistic Test p-value:4.85E-08; Z-score:-8.27E+00

Methylation in Case

8.48E-02 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in bladder cancer [ 2 ]

Location

TSS1500 (cg02659138)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:5.23E-06; Z-score:-9.19E+00

Methylation in Case

6.67E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B4 in bladder cancer [ 2 ]

Location

Body (cg10598428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:1.47E-02; Z-score:-2.12E+00

Methylation in Case

4.45E-02 (Median) Methylation in Control 5.81E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC35B4 in bladder cancer [ 2 ]

Location

Body (cg24333621)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.99E-02; Z-score:3.33E+00

Methylation in Case

8.67E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC35B4 in bladder cancer [ 2 ]

Location

Body (cg07598034)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:3.24E-02; Z-score:-1.26E+00

Methylation in Case

4.44E-02 (Median) Methylation in Control 5.13E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC35B4 in bladder cancer [ 2 ]

Location

3'UTR (cg16785291)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.71E+00 Statistic Test p-value:9.21E-08; Z-score:7.41E+00

Methylation in Case

8.43E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in breast cancer [ 3 ]

Location

TSS1500 (cg02659138)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:7.25E-16; Z-score:-3.97E+00

Methylation in Case

6.68E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in breast cancer [ 3 ]

Location

TSS1500 (cg02820759)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.89E-02; Z-score:4.37E-01

Methylation in Case

1.24E-01 (Median) Methylation in Control 1.15E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in breast cancer [ 3 ]

Location

TSS200 (cg23601994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.70E+00 Statistic Test p-value:7.89E-04; Z-score:-5.51E-01

Methylation in Case

3.22E-03 (Median) Methylation in Control 5.46E-03 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B4 in breast cancer [ 3 ]

Location

TSS200 (cg24404943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.51E-02; Z-score:-2.28E-01

Methylation in Case

5.86E-02 (Median) Methylation in Control 6.22E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC35B4 in breast cancer [ 3 ]

Location

3'UTR (cg16785291)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:4.30E-19; Z-score:2.87E+00

Methylation in Case

7.74E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg27581047)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.18E-02; Z-score:2.42E-01

Methylation in Case

7.53E-02 (Median) Methylation in Control 6.91E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg02659138)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:3.48E-02; Z-score:4.42E-01

Methylation in Case

9.52E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg24404943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.43E-02; Z-score:7.08E-01

Methylation in Case

2.44E-02 (Median) Methylation in Control 2.07E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B4 in clear cell renal cell carcinoma [ 4 ]

Location

TSS200 (cg23601994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.80E-02; Z-score:3.17E-01

Methylation in Case

1.06E-02 (Median) Methylation in Control 1.03E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in colorectal cancer [ 5 ]

Location

TSS1500 (cg02659138)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.96E-07; Z-score:-2.26E+00

Methylation in Case

8.08E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in colorectal cancer [ 5 ]

Location

TSS1500 (cg27581047)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.09E-02; Z-score:-1.00E+00

Methylation in Case

2.08E-01 (Median) Methylation in Control 2.56E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in colorectal cancer [ 5 ]

Location

TSS200 (cg00033643)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.87E-02; Z-score:-3.94E-01

Methylation in Case

4.20E-02 (Median) Methylation in Control 5.14E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B4 in colorectal cancer [ 5 ]

Location

TSS200 (cg24404943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.35E-02; Z-score:4.35E-01

Methylation in Case

1.03E-01 (Median) Methylation in Control 9.60E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC35B4 in colorectal cancer [ 5 ]

Location

Body (cg13375479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.07E-04; Z-score:1.13E+00

Methylation in Case

9.11E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC35B4 in colorectal cancer [ 5 ]

Location

Body (cg24333621)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.42E-03; Z-score:-8.09E-01

Methylation in Case

9.05E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC35B4 in colorectal cancer [ 5 ]

Location

Body (cg23721242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:7.13E-03; Z-score:6.31E-01

Methylation in Case

7.38E-02 (Median) Methylation in Control 6.77E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg01007458)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.59E+00 Statistic Test p-value:2.05E-18; Z-score:-6.47E+00

Methylation in Case

4.14E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg27581047)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:2.82E-06; Z-score:-1.30E+00

Methylation in Case

1.15E-01 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg02659138)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.89E-05; Z-score:-8.83E-01

Methylation in Case

7.90E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B4 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg02820759)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:8.30E-03; Z-score:-5.35E-01

Methylation in Case

1.28E-01 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC35B4 in hepatocellular carcinoma [ 6 ]

Location

Body (cg10598428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.43E-02; Z-score:-3.46E-01

Methylation in Case

4.81E-02 (Median) Methylation in Control 5.10E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg04093149)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:4.02E-05; Z-score:1.25E+00

Methylation in Case

5.92E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg14178422)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.17E-02; Z-score:-8.06E-01

Methylation in Case

7.78E-02 (Median) Methylation in Control 8.94E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg09629631)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.51E-02; Z-score:9.62E-01

Methylation in Case

5.56E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in papillary thyroid cancer [ 8 ]

Location

TSS1500 (cg02820759)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.14E-02; Z-score:-6.95E-01

Methylation in Case

1.31E-01 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in papillary thyroid cancer [ 8 ]

Location

Body (cg24333621)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.73E-10; Z-score:-1.89E+00

Methylation in Case

8.72E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in papillary thyroid cancer [ 8 ]

Location

3'UTR (cg16785291)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.50E-02; Z-score:7.24E-01

Methylation in Case

9.09E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in systemic lupus erythematosus [ 9 ]

Location

TSS1500 (cg02820759)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:5.61E-04; Z-score:-4.07E-01

Methylation in Case

3.37E-01 (Median) Methylation in Control 3.68E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in systemic lupus erythematosus [ 9 ]

Location

TSS200 (cg24404943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.26E-02; Z-score:-1.23E-01

Methylation in Case

8.61E-02 (Median) Methylation in Control 8.83E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in systemic lupus erythematosus [ 9 ]

Location

Body (cg07718324)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.00E-02; Z-score:1.71E-01

Methylation in Case

6.30E-01 (Median) Methylation in Control 6.24E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B4 in systemic lupus erythematosus [ 9 ]

Location

Body (cg24333621)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.64E-02; Z-score:-2.19E-01

Methylation in Case

8.55E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  HIV infection

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in HIV infection [ 10 ]

Location

TSS200 (cg23601994)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:4.68E-02; Z-score:4.39E-01

Methylation in Case

5.35E-03 (Median) Methylation in Control 4.11E-03 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in HIV infection [ 10 ]

Location

Body (cg24333621)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:3.83E-06; Z-score:2.01E+00

Methylation in Case

7.86E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Panic disorder

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in panic disorder [ 11 ]

Location

TSS200 (cg24404943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.67E-01 Statistic Test p-value:1.99E-03; Z-score:5.42E-01

Methylation in Case

-4.49E+00 (Median) Methylation in Control -4.64E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in panic disorder [ 11 ]

Location

Body (cg20476274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.62E-02; Z-score:-3.86E-01

Methylation in Case

4.19E+00 (Median) Methylation in Control 4.34E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in panic disorder [ 11 ]

Location

Body (cg13375479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:4.43E-02; Z-score:-4.33E-01

Methylation in Case

5.17E-01 (Median) Methylation in Control 6.69E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07598034)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:4.44E-03; Z-score:8.05E-01

Methylation in Case

5.80E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07718324)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:4.95E-03; Z-score:-8.66E-01

Methylation in Case

1.18E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg10598428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:1.62E-02; Z-score:6.48E-01

Methylation in Case

8.00E-01 (Median) Methylation in Control 7.28E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B4 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg12706662)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.93E-02; Z-score:5.94E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC35B4 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg13375479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.56E-02; Z-score:6.41E-01

Methylation in Case

8.59E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC35B4 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg16785291)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.59E+00 Statistic Test p-value:8.78E-11; Z-score:-1.92E+00

Methylation in Case

3.97E-01 (Median) Methylation in Control 6.30E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in lung adenocarcinoma [ 13 ]

Location

Body (cg13375479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.79E-03; Z-score:1.07E+00

Methylation in Case

9.05E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B4 in prostate cancer [ 14 ]

Location

Body (cg15053022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.89E+00 Statistic Test p-value:3.63E-05; Z-score:9.87E+00

Methylation in Case

6.74E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B4 in prostate cancer [ 14 ]

Location

Body (cg17798847)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:4.58E-03; Z-score:3.46E+00

Methylation in Case

9.46E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B4 in prostate cancer [ 14 ]

Location

Body (cg04836214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:7.85E-03; Z-score:2.83E+00

Methylation in Case

8.19E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         23 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-129 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1295b directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1295b miRNA Mature ID miR-1295b-3p

miRNA Sequence

AAUAGGCCACGGAUCUGGGCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1304 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-181a directly targets SLC35B4 [ 16 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-181a miRNA Mature ID miR-181a-5p

miRNA Sequence

AACAUUCAACGCUGUCGGUGAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-182 directly targets SLC35B4 [ 17 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-182 miRNA Mature ID miR-182-3p

miRNA Sequence

UGGUUCUAGACUUGCCAACUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-192 directly targets SLC35B4 [ 18 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

CUGACCUAUGAAUUGACAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-215 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-3p

miRNA Sequence

UCUGUCAUUUCUUUAGGCCAAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-215 directly targets SLC35B4 [ 18 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

AUGACCUAUGAAUUGACAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-26a directly targets SLC35B4 [ 17 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-26a miRNA Mature ID miR-26a-5p

miRNA Sequence

UUCAAGUAAUCCAGGAUAGGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-329 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

AACACACCUGGUUAACCUCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-362 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

AACACACCUAUUCAAGGAUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-3664 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3664 miRNA Mature ID miR-3664-5p

miRNA Sequence

AACUCUGUCUUCACUCAUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-3941 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

UUACACACAACUGAGGAUCAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-4639 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4639 miRNA Mature ID miR-4639-3p

miRNA Sequence

UCACUCUCACCUUGCUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-4796 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4796 miRNA Mature ID miR-4796-5p

miRNA Sequence

UGUCUAUACUCUGUCACUUUAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-5007 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5007 miRNA Mature ID miR-5007-5p

miRNA Sequence

UAGAGUCUGGCUGAUAUGGUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-500b directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-500b miRNA Mature ID miR-500b-3p

miRNA Sequence

GCACCCAGGCAAGGAUUCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-6773 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6773 miRNA Mature ID miR-6773-3p

miRNA Sequence

ACUGUCACUUCUCUGCCCAUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-6794 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6794 miRNA Mature ID miR-6794-3p

miRNA Sequence

CUCACUCUCAGUCCCUCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-6844 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6844 miRNA Mature ID miR-6844

miRNA Sequence

UUCUUUGUUUUUAAUUCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-6879 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6879 miRNA Mature ID miR-6879-3p

miRNA Sequence

UGUCACCCGCUCCUUGCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-744 directly targets SLC35B4 [ 17 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-744 miRNA Mature ID miR-744-5p

miRNA Sequence

UGCGGGGCUAGGGCUAACAGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon23

miR-8055 directly targets SLC35B4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8055 miRNA Mature ID miR-8055

miRNA Sequence

CUUUGAGCACAUGAGCAGACGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
17 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
18 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.