Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0294 Transporter Info | ||||
| Gene Name | SLC35B3 | ||||
| Transporter Name | Adenosine 3'-phospho 5'-phosphosulfate transporter 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
37 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1297 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1297 | miRNA Mature ID | miR-1297 | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-130b directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-130b | miRNA Mature ID | miR-130b-5p | ||
|
miRNA Sequence |
ACUCUUUCCCUGUUGCACUAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-15a directly targets SLC35B3 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
|
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-16 directly targets SLC35B3 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
|
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-26a directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-26a | miRNA Mature ID | miR-26a-5p | ||
|
miRNA Sequence |
UUCAAGUAAUCCAGGAUAGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-26b directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-29b-2 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-29b-2 | miRNA Mature ID | miR-29b-2-5p | ||
|
miRNA Sequence |
CUGGUUUCACAUGGUGGCUUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-302a directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302a | miRNA Mature ID | miR-302a-5p | ||
|
miRNA Sequence |
ACUUAAACGUGGAUGUACUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-3121 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3121 | miRNA Mature ID | miR-3121-5p | ||
|
miRNA Sequence |
UCCUUUGCCUAUUCUAUUUAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-3145 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3145 | miRNA Mature ID | miR-3145-5p | ||
|
miRNA Sequence |
AACUCCAAACACUCAAAACUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-3908 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3908 | miRNA Mature ID | miR-3908 | ||
|
miRNA Sequence |
GAGCAAUGUAGGUAGACUGUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-4465 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4465 | miRNA Mature ID | miR-4465 | ||
|
miRNA Sequence |
CUCAAGUAGUCUGACCAGGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-4659a directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4659a | miRNA Mature ID | miR-4659a-3p | ||
|
miRNA Sequence |
UUUCUUCUUAGACAUGGCAACG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-4659b directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4659b | miRNA Mature ID | miR-4659b-3p | ||
|
miRNA Sequence |
UUUCUUCUUAGACAUGGCAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-4753 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4753 | miRNA Mature ID | miR-4753-3p | ||
|
miRNA Sequence |
UUCUCUUUCUUUAGCCUUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-4778 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4778 | miRNA Mature ID | miR-4778-3p | ||
|
miRNA Sequence |
UCUUCUUCCUUUGCAGAGUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-488 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-488 | miRNA Mature ID | miR-488-5p | ||
|
miRNA Sequence |
CCCAGAUAAUGGCACUCUCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon18 |
miR-500a directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-500a | miRNA Mature ID | miR-500a-5p | ||
|
miRNA Sequence |
UAAUCCUUGCUACCUGGGUGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-501 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-501 | miRNA Mature ID | miR-501-5p | ||
|
miRNA Sequence |
AAUCCUUUGUCCCUGGGUGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon20 |
miR-508 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-508 | miRNA Mature ID | miR-508-5p | ||
|
miRNA Sequence |
UACUCCAGAGGGCGUCACUCAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-548az directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548az | miRNA Mature ID | miR-548az-5p | ||
|
miRNA Sequence |
CAAAAGUGAUUGUGGUUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon22 |
miR-548n directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548n | miRNA Mature ID | miR-548n | ||
|
miRNA Sequence |
CAAAAGUAAUUGUGGAUUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon23 |
miR-548t directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548t | miRNA Mature ID | miR-548t-5p | ||
|
miRNA Sequence |
CAAAAGUGAUCGUGGUUUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon24 |
miR-550b directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-550b | miRNA Mature ID | miR-550b-3p | ||
|
miRNA Sequence |
UCUUACUCCCUCAGGCACUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon25 |
miR-561 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-561 | miRNA Mature ID | miR-561-3p | ||
|
miRNA Sequence |
CAAAGUUUAAGAUCCUUGAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon26 |
miR-5697 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5697 | miRNA Mature ID | miR-5697 | ||
|
miRNA Sequence |
UCAAGUAGUUUCAUGAUAAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon27 |
miR-627 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-627 | miRNA Mature ID | miR-627-3p | ||
|
miRNA Sequence |
UCUUUUCUUUGAGACUCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon28 |
miR-659 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-659 | miRNA Mature ID | miR-659-3p | ||
|
miRNA Sequence |
CUUGGUUCAGGGAGGGUCCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon29 |
miR-6778 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-3p | ||
|
miRNA Sequence |
UGCCUCCCUGACAUUCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon30 |
miR-6791 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6791 | miRNA Mature ID | miR-6791-3p | ||
|
miRNA Sequence |
UGCCUCCUUGGUCUCCGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon31 |
miR-6809 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6809 | miRNA Mature ID | miR-6809-3p | ||
|
miRNA Sequence |
CUUCUCUUCUCUCCUUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon32 |
miR-6817 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6817 | miRNA Mature ID | miR-6817-3p | ||
|
miRNA Sequence |
UCUCUCUGACUCCAUGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon33 |
miR-6829 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-3p | ||
|
miRNA Sequence |
UGCCUCCUCCGUGGCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon34 |
miR-6836 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6836 | miRNA Mature ID | miR-6836-3p | ||
|
miRNA Sequence |
AUGCCUCCCCCGGCCCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon35 |
miR-6875 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6875 | miRNA Mature ID | miR-6875-3p | ||
|
miRNA Sequence |
AUUCUUCCUGCCCUGGCUCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon36 |
miR-7110 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7110 | miRNA Mature ID | miR-7110-3p | ||
|
miRNA Sequence |
UCUCUCUCCCACUUCCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon37 |
miR-9 directly targets SLC35B3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-9 | miRNA Mature ID | miR-9-5p | ||
|
miRNA Sequence |
UCUUUGGUUAUCUAGCUGUAUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
|
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC35B3 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:7.01E-12; Fold-change:-0.258660585; Z-score:-5.350627941 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples