General Information of Drug Transporter (DT)
DT ID DTD0293 Transporter Info
Gene Name SLC35B2
Transporter Name Adenosine 3'-phospho 5'-phosphosulfate transporter 1
Gene ID
347734
UniProt ID
Q8TB61
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in breast cancer [ 1 ]

Location

TSS1500 (cg11699666)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:5.14E-04; Z-score:7.87E-01

Methylation in Case

5.82E-02 (Median) Methylation in Control 4.59E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in clear cell renal cell carcinoma [ 2 ]

Location

TSS1500 (cg24132692)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:3.80E-03; Z-score:6.87E-01

Methylation in Case

1.32E-02 (Median) Methylation in Control 1.15E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B2 in clear cell renal cell carcinoma [ 2 ]

Location

TSS200 (cg13146826)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:1.23E-03; Z-score:6.45E-01

Methylation in Case

1.16E-02 (Median) Methylation in Control 1.02E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in papillary thyroid cancer [ 3 ]

Location

TSS1500 (cg11699666)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:4.71E-13; Z-score:-1.81E+00

Methylation in Case

4.07E-02 (Median) Methylation in Control 6.08E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in bladder cancer [ 4 ]

Location

Body (cg00071051)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.68E+00 Statistic Test p-value:1.09E-10; Z-score:-1.99E+01

Methylation in Case

2.72E-01 (Median) Methylation in Control 4.57E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Colon cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in colon adenocarcinoma [ 5 ]

Location

Body (cg05981741)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.26E-04; Z-score:-2.04E+00

Methylation in Case

8.13E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B2 in colon adenocarcinoma [ 5 ]

Location

Body (cg23867721)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:6.10E-04; Z-score:-2.11E+00

Methylation in Case

6.14E-01 (Median) Methylation in Control 6.83E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in colorectal cancer [ 6 ]

Location

Body (cg20144576)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:4.91E-02; Z-score:-4.14E-01

Methylation in Case

2.94E-02 (Median) Methylation in Control 3.68E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B2 in colorectal cancer [ 6 ]

Location

3'UTR (cg06440160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.88E-02; Z-score:-6.83E-01

Methylation in Case

8.88E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg00071051)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:4.44E-07; Z-score:-1.42E+00

Methylation in Case

3.40E-01 (Median) Methylation in Control 4.03E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg13917287)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.74E-05; Z-score:1.08E+00

Methylation in Case

8.38E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B2 in panic disorder [ 9 ]

Location

Body (cg06636077)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.87E-01 Statistic Test p-value:6.25E-03; Z-score:2.82E-01

Methylation in Case

-5.24E+00 (Median) Methylation in Control -5.31E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-103a directly targets SLC35B2 [ 10 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-16 directly targets SLC35B2 [ 11 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon3

miR-24 directly targets SLC35B2 [ 10 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-3921 directly targets SLC35B2 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3921 miRNA Mature ID miR-3921

miRNA Sequence

UCUCUGAGUACCAUAUGCCUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-4522 directly targets SLC35B2 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4522 miRNA Mature ID miR-4522

miRNA Sequence

UGACUCUGCCUGUAGGCCGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-4653 directly targets SLC35B2 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4653 miRNA Mature ID miR-4653-5p

miRNA Sequence

UCUCUGAGCAAGGCUUAACACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-4714 directly targets SLC35B2 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4714 miRNA Mature ID miR-4714-5p

miRNA Sequence

AACUCUGACCCCUUAGGUUGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-483 directly targets SLC35B2 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-483 miRNA Mature ID miR-483-5p

miRNA Sequence

AAGACGGGAGGAAAGAAGGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
4 DNA Methylation Dynamics in Urological Tumors.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
11 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
12 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.