General Information of Drug Transporter (DT)
DT ID DTD0292 Transporter Info
Gene Name SLC35B1
Transporter Name UDP-galactose transporter-related protein 1
Gene ID
10237
UniProt ID
P78383
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

5'UTR (cg16029760)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.05E+00 Statistic Test p-value:1.36E-19; Z-score:3.62E+00

Methylation in Case

4.97E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg07629187)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.28E+00 Statistic Test p-value:1.11E-09; Z-score:4.85E+00

Methylation in Case

1.71E-01 (Median) Methylation in Control 7.52E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg06375292)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.43E-05; Z-score:-9.15E-01

Methylation in Case

6.35E-01 (Median) Methylation in Control 6.97E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

TSS200 (cg26417642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.08E+00 Statistic Test p-value:6.92E-10; Z-score:5.10E+00

Methylation in Case

9.23E-02 (Median) Methylation in Control 2.26E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC35B1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg15889012)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.43E+00 Statistic Test p-value:7.01E-12; Z-score:1.93E+00

Methylation in Case

4.83E-01 (Median) Methylation in Control 3.38E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B1 in breast cancer [ 2 ]

Location

TSS1500 (cg23576473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:7.90E-03; Z-score:-3.94E-01

Methylation in Case

2.67E-02 (Median) Methylation in Control 3.29E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B1 in colorectal cancer [ 3 ]

Location

TSS1500 (cg06016431)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.81E-03; Z-score:-3.68E-01

Methylation in Case

7.29E-02 (Median) Methylation in Control 8.23E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B1 in colorectal cancer [ 3 ]

Location

TSS1500 (cg23576473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.28E-02; Z-score:-3.29E-01

Methylation in Case

5.34E-02 (Median) Methylation in Control 5.82E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B1 in colorectal cancer [ 3 ]

Location

TSS200 (cg00909976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:7.72E-03; Z-score:5.06E-01

Methylation in Case

2.12E-02 (Median) Methylation in Control 1.90E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B1 in colorectal cancer [ 3 ]

Location

Body (cg27658080)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:4.20E-02; Z-score:-4.65E-01

Methylation in Case

8.34E-02 (Median) Methylation in Control 9.13E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B1 in lung adenocarcinoma [ 4 ]

Location

TSS1500 (cg23576473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:2.68E-03; Z-score:2.03E+00

Methylation in Case

6.25E-02 (Median) Methylation in Control 5.35E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B1 in lung adenocarcinoma [ 4 ]

Location

TSS1500 (cg06016431)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.59E-02; Z-score:7.25E-01

Methylation in Case

7.25E-02 (Median) Methylation in Control 6.94E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B1 in lung adenocarcinoma [ 4 ]

Location

TSS1500 (cg06375292)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.81E-02; Z-score:9.58E-01

Methylation in Case

6.52E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC35B1 in lung adenocarcinoma [ 4 ]

Location

TSS200 (cg01650744)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:2.75E-02; Z-score:1.02E+00

Methylation in Case

6.76E-02 (Median) Methylation in Control 6.02E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B1 in pancretic ductal adenocarcinoma [ 5 ]

Location

TSS1500 (cg25185710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.52E-03; Z-score:-5.90E-01

Methylation in Case

1.33E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B1 in panic disorder [ 6 ]

Location

TSS1500 (cg06375292)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.62E-02; Z-score:2.44E-01

Methylation in Case

2.60E+00 (Median) Methylation in Control 2.50E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B1 in papillary thyroid cancer [ 7 ]

Location

TSS1500 (cg23576473)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.44E-02; Z-score:-2.22E-01

Methylation in Case

2.75E-02 (Median) Methylation in Control 2.92E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B1 in papillary thyroid cancer [ 7 ]

Location

TSS200 (cg00909976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.75E-02; Z-score:-2.40E-01

Methylation in Case

6.33E-02 (Median) Methylation in Control 6.49E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Bladder cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35B1 in bladder cancer [ 8 ]

Location

TSS200 (cg00909976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:4.09E-02; Z-score:-1.32E+00

Methylation in Case

3.27E-02 (Median) Methylation in Control 4.51E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC35B1 in bladder cancer [ 8 ]

Location

TSS200 (cg01650744)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:4.78E-02; Z-score:-1.89E+00

Methylation in Case

4.07E-02 (Median) Methylation in Control 4.89E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC35B1 in bladder cancer [ 8 ]

Location

Body (cg27658080)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:4.01E-02; Z-score:-1.35E+00

Methylation in Case

4.59E-02 (Median) Methylation in Control 5.06E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1236 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1236 miRNA Mature ID miR-1236-3p

miRNA Sequence

CCUCUUCCCCUUGUCUCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1470 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1470 miRNA Mature ID miR-1470

miRNA Sequence

GCCCUCCGCCCGUGCACCCCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-2276 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2276 miRNA Mature ID miR-2276-5p

miRNA Sequence

GCCCUCUGUCACCUUGCAGACG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-2682 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2682 miRNA Mature ID miR-2682-3p

miRNA Sequence

CGCCUCUUCAGCGCUGUCUUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-3194 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3194 miRNA Mature ID miR-3194-3p

miRNA Sequence

AGCUCUGCUGCUCACUGGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-4267 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4267 miRNA Mature ID miR-4267

miRNA Sequence

UCCAGCUCGGUGGCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-4469 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4469 miRNA Mature ID miR-4469

miRNA Sequence

GCUCCCUCUAGGGUCGCUCGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-4667 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4667 miRNA Mature ID miR-4667-3p

miRNA Sequence

UCCCUCCUUCUGUCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-4699 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4699 miRNA Mature ID miR-4699-3p

miRNA Sequence

AAUUUACUCUGCAAUCUUCUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-5001 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5001 miRNA Mature ID miR-5001-3p

miRNA Sequence

UUCUGCCUCUGUCCAGGUCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-5586 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5586 miRNA Mature ID miR-5586-5p

miRNA Sequence

UAUCCAGCUUGUUACUAUAUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-642a directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-642a miRNA Mature ID miR-642a-5p

miRNA Sequence

GUCCCUCUCCAAAUGUGUCUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-6781 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6781 miRNA Mature ID miR-6781-3p

miRNA Sequence

UGCCUCUUUUCCACGGCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-6892 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6892 miRNA Mature ID miR-6892-3p

miRNA Sequence

UCCCUCUCCCACCCCUUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-877 directly targets SLC35B1 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-877 miRNA Mature ID miR-877-3p

miRNA Sequence

UCCUCUUCUCCCUCCUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 DNA Methylation Dynamics in Urological Tumors.
9 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.