Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0292 Transporter Info | ||||
| Gene Name | SLC35B1 | ||||
| Transporter Name | UDP-galactose transporter-related protein 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Hepatocellular carcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC35B1 in hepatocellular carcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg16029760) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.05E+00 | Statistic Test | p-value:1.36E-19; Z-score:3.62E+00 | ||
|
Methylation in Case |
4.97E-01 (Median) | Methylation in Control | 2.43E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC35B1 in hepatocellular carcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg07629187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.28E+00 | Statistic Test | p-value:1.11E-09; Z-score:4.85E+00 | ||
|
Methylation in Case |
1.71E-01 (Median) | Methylation in Control | 7.52E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC35B1 in hepatocellular carcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg06375292) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.43E-05; Z-score:-9.15E-01 | ||
|
Methylation in Case |
6.35E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC35B1 in hepatocellular carcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg26417642) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.08E+00 | Statistic Test | p-value:6.92E-10; Z-score:5.10E+00 | ||
|
Methylation in Case |
9.23E-02 (Median) | Methylation in Control | 2.26E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC35B1 in hepatocellular carcinoma | [ 1 ] | |||
|
Location |
Body (cg15889012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.43E+00 | Statistic Test | p-value:7.01E-12; Z-score:1.93E+00 | ||
|
Methylation in Case |
4.83E-01 (Median) | Methylation in Control | 3.38E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC35B1 in breast cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg23576473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:7.90E-03; Z-score:-3.94E-01 | ||
|
Methylation in Case |
2.67E-02 (Median) | Methylation in Control | 3.29E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC35B1 in colorectal cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg06016431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.81E-03; Z-score:-3.68E-01 | ||
|
Methylation in Case |
7.29E-02 (Median) | Methylation in Control | 8.23E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC35B1 in colorectal cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg23576473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:3.28E-02; Z-score:-3.29E-01 | ||
|
Methylation in Case |
5.34E-02 (Median) | Methylation in Control | 5.82E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC35B1 in colorectal cancer | [ 3 ] | |||
|
Location |
TSS200 (cg00909976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:7.72E-03; Z-score:5.06E-01 | ||
|
Methylation in Case |
2.12E-02 (Median) | Methylation in Control | 1.90E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC35B1 in colorectal cancer | [ 3 ] | |||
|
Location |
Body (cg27658080) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.20E-02; Z-score:-4.65E-01 | ||
|
Methylation in Case |
8.34E-02 (Median) | Methylation in Control | 9.13E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC35B1 in lung adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg23576473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:2.68E-03; Z-score:2.03E+00 | ||
|
Methylation in Case |
6.25E-02 (Median) | Methylation in Control | 5.35E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC35B1 in lung adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg06016431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.59E-02; Z-score:7.25E-01 | ||
|
Methylation in Case |
7.25E-02 (Median) | Methylation in Control | 6.94E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC35B1 in lung adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg06375292) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.81E-02; Z-score:9.58E-01 | ||
|
Methylation in Case |
6.52E-01 (Median) | Methylation in Control | 6.08E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC35B1 in lung adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg01650744) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:2.75E-02; Z-score:1.02E+00 | ||
|
Methylation in Case |
6.76E-02 (Median) | Methylation in Control | 6.02E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC35B1 in pancretic ductal adenocarcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg25185710) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:1.52E-03; Z-score:-5.90E-01 | ||
|
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC35B1 in panic disorder | [ 6 ] | |||
|
Location |
TSS1500 (cg06375292) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.62E-02; Z-score:2.44E-01 | ||
|
Methylation in Case |
2.60E+00 (Median) | Methylation in Control | 2.50E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC35B1 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg23576473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.44E-02; Z-score:-2.22E-01 | ||
|
Methylation in Case |
2.75E-02 (Median) | Methylation in Control | 2.92E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC35B1 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
TSS200 (cg00909976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.75E-02; Z-score:-2.40E-01 | ||
|
Methylation in Case |
6.33E-02 (Median) | Methylation in Control | 6.49E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC35B1 in bladder cancer | [ 8 ] | |||
|
Location |
TSS200 (cg00909976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:4.09E-02; Z-score:-1.32E+00 | ||
|
Methylation in Case |
3.27E-02 (Median) | Methylation in Control | 4.51E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC35B1 in bladder cancer | [ 8 ] | |||
|
Location |
TSS200 (cg01650744) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:4.78E-02; Z-score:-1.89E+00 | ||
|
Methylation in Case |
4.07E-02 (Median) | Methylation in Control | 4.89E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC35B1 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg27658080) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.01E-02; Z-score:-1.35E+00 | ||
|
Methylation in Case |
4.59E-02 (Median) | Methylation in Control | 5.06E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1236 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1236 | miRNA Mature ID | miR-1236-3p | ||
|
miRNA Sequence |
CCUCUUCCCCUUGUCUCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1470 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1470 | miRNA Mature ID | miR-1470 | ||
|
miRNA Sequence |
GCCCUCCGCCCGUGCACCCCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-2276 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2276 | miRNA Mature ID | miR-2276-5p | ||
|
miRNA Sequence |
GCCCUCUGUCACCUUGCAGACG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-2682 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2682 | miRNA Mature ID | miR-2682-3p | ||
|
miRNA Sequence |
CGCCUCUUCAGCGCUGUCUUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-3194 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3194 | miRNA Mature ID | miR-3194-3p | ||
|
miRNA Sequence |
AGCUCUGCUGCUCACUGGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-4267 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4267 | miRNA Mature ID | miR-4267 | ||
|
miRNA Sequence |
UCCAGCUCGGUGGCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-4469 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4469 | miRNA Mature ID | miR-4469 | ||
|
miRNA Sequence |
GCUCCCUCUAGGGUCGCUCGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-4667 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4667 | miRNA Mature ID | miR-4667-3p | ||
|
miRNA Sequence |
UCCCUCCUUCUGUCCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-4699 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4699 | miRNA Mature ID | miR-4699-3p | ||
|
miRNA Sequence |
AAUUUACUCUGCAAUCUUCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-5001 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5001 | miRNA Mature ID | miR-5001-3p | ||
|
miRNA Sequence |
UUCUGCCUCUGUCCAGGUCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-5586 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5586 | miRNA Mature ID | miR-5586-5p | ||
|
miRNA Sequence |
UAUCCAGCUUGUUACUAUAUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-642a directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-642a | miRNA Mature ID | miR-642a-5p | ||
|
miRNA Sequence |
GUCCCUCUCCAAAUGUGUCUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-6781 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6781 | miRNA Mature ID | miR-6781-3p | ||
|
miRNA Sequence |
UGCCUCUUUUCCACGGCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-6892 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6892 | miRNA Mature ID | miR-6892-3p | ||
|
miRNA Sequence |
UCCCUCUCCCACCCCUUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-877 directly targets SLC35B1 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-877 | miRNA Mature ID | miR-877-3p | ||
|
miRNA Sequence |
UCCUCUUCUCCCUCCUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.