Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0291 Transporter Info | ||||
Gene Name | SLC35A5 | ||||
Transporter Name | Probable UDP-sugar transporter protein SLC35A5 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Bladder cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC35A5 in bladder cancer | [ 1 ] | |||
Location |
5'UTR (cg03599590) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-3.18E+00 | Statistic Test | p-value:2.39E-11; Z-score:-9.83E+00 | ||
Methylation in Case |
7.70E-02 (Median) | Methylation in Control | 2.45E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC35A5 in bladder cancer | [ 1 ] | |||
Location |
Body (cg01443337) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.53E+00 | Statistic Test | p-value:8.57E-08; Z-score:-1.82E+01 | ||
Methylation in Case |
5.07E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC35A5 in bladder cancer | [ 1 ] | |||
Location |
3'UTR (cg25707238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.51E-02; Z-score:-8.28E-01 | ||
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC35A5 in breast cancer | [ 2 ] | |||
Location |
5'UTR (cg03599590) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.74E+00 | Statistic Test | p-value:2.41E-06; Z-score:-2.52E+00 | ||
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 2.32E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC35A5 in breast cancer | [ 2 ] | |||
Location |
Body (cg01443337) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.17E-03; Z-score:-2.38E-02 | ||
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 7.77E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC35A5 in breast cancer | [ 2 ] | |||
Location |
3'UTR (cg25707238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.53E-04; Z-score:-9.16E-01 | ||
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC35A5 in hepatocellular carcinoma | [ 3 ] | |||
Location |
5'UTR (cg03599590) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:1.86E-02; Z-score:-1.09E+00 | ||
Methylation in Case |
1.42E-01 (Median) | Methylation in Control | 1.86E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC35A5 in hepatocellular carcinoma | [ 3 ] | |||
Location |
Body (cg14413177) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.43E+00 | Statistic Test | p-value:1.29E-15; Z-score:-2.26E+00 | ||
Methylation in Case |
3.26E-01 (Median) | Methylation in Control | 4.67E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC35A5 in hepatocellular carcinoma | [ 3 ] | |||
Location |
Body (cg24855956) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:2.69E-10; Z-score:-4.22E+00 | ||
Methylation in Case |
5.79E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC35A5 in lung adenocarcinoma | [ 4 ] | |||
Location |
5'UTR (cg03599590) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:4.11E-02; Z-score:-7.78E-01 | ||
Methylation in Case |
2.76E-01 (Median) | Methylation in Control | 3.16E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC35A5 in lung adenocarcinoma | [ 4 ] | |||
Location |
3'UTR (cg25707238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:8.96E-03; Z-score:-1.25E+00 | ||
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC35A5 in papillary thyroid cancer | [ 5 ] | |||
Location |
5'UTR (cg03599590) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:1.23E-07; Z-score:-1.13E+00 | ||
Methylation in Case |
1.72E-01 (Median) | Methylation in Control | 2.37E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC35A5 in papillary thyroid cancer | [ 5 ] | |||
Location |
Body (cg09473763) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.10E-04; Z-score:-7.99E-01 | ||
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Pancretic ductal adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC35A5 in pancretic ductal adenocarcinoma | [ 6 ] | |||
Location |
TSS1500 (cg21088438) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:1.55E-06; Z-score:-1.45E+00 | ||
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC35A5 in pancretic ductal adenocarcinoma | [ 6 ] | |||
Location |
TSS200 (cg25353142) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:6.09E-12; Z-score:-1.61E+00 | ||
Methylation in Case |
2.01E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC35A5 in pancretic ductal adenocarcinoma | [ 6 ] | |||
Location |
Body (cg16397021) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:7.81E-05; Z-score:1.26E+00 | ||
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 6.52E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC35A5 in colorectal cancer | [ 7 ] | |||
Location |
3'UTR (cg25707238) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.90E-02; Z-score:3.36E-01 | ||
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
let-7a directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7a | miRNA Mature ID | let-7a-3p | ||
miRNA Sequence |
CUAUACAAUCUACUGUCUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon2 |
let-7b directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-3p | ||
miRNA Sequence |
CUAUACAACCUACUGCCUUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon3 |
let-7f-1 directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
let-7f-1 | miRNA Mature ID | let-7f-1-3p | ||
miRNA Sequence |
CUAUACAAUCUAUUGCCUUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon4 |
miR-1 directly targets SLC35A5 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon5 |
miR-300 directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-300 | miRNA Mature ID | miR-300 | ||
miRNA Sequence |
UAUACAAGGGCAGACUCUCUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon6 |
miR-3129 directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3129 | miRNA Mature ID | miR-3129-3p | ||
miRNA Sequence |
AAACUAAUCUCUACACUGCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon7 |
miR-335 directly targets SLC35A5 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-338 directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-338 | miRNA Mature ID | miR-338-5p | ||
miRNA Sequence |
AACAAUAUCCUGGUGCUGAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon9 |
miR-381 directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-381 | miRNA Mature ID | miR-381-3p | ||
miRNA Sequence |
UAUACAAGGGCAAGCUCUCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon10 |
miR-4666a directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4666a | miRNA Mature ID | miR-4666a-3p | ||
miRNA Sequence |
CAUACAAUCUGACAUGUAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon11 |
miR-558 directly targets SLC35A5 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-558 | miRNA Mature ID | miR-558 | ||
miRNA Sequence |
UGAGCUGCUGUACCAAAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon12 |
miR-5583 directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5583 | miRNA Mature ID | miR-5583-5p | ||
miRNA Sequence |
AAACUAAUAUACCCAUAUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon13 |
miR-7 directly targets SLC35A5 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-7 | miRNA Mature ID | miR-7-5p | ||
miRNA Sequence |
UGGAAGACUAGUGAUUUUGUUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon14 |
miR-802 directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-802 | miRNA Mature ID | miR-802 | ||
miRNA Sequence |
CAGUAACAAAGAUUCAUCCUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon15 |
miR-98 directly targets SLC35A5 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-98 | miRNA Mature ID | miR-98-3p | ||
miRNA Sequence |
CUAUACAACUUACUACUUUCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.