Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0289 Transporter Info
Gene Name SLC35A3
Transporter Name UDP-N-acetylglucosamine transporter
Gene ID
23443
UniProt ID
Q9Y2D2
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in bladder cancer [ 1 ]

Location

 5'UTR (cg14215483)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.30E+00 Statistic Test p-value:2.81E-06; Z-score:-1.05E+01

Methylation in Case

 6.75E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in bladder cancer [ 1 ]

Location

 TSS1500 (cg20868668)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.09E+00 Statistic Test p-value:8.07E-06; Z-score:-4.83E+00

Methylation in Case

 1.14E-01 (Median) Methylation in Control 2.39E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in bladder cancer [ 1 ]

Location

 TSS1500 (cg12909559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.71E+00 Statistic Test p-value:3.20E-02; Z-score:-1.19E+00

Methylation in Case

 2.49E-02 (Median) Methylation in Control 4.24E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in breast cancer [ 2 ]

Location

 5'UTR (cg19499674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.27E+00 Statistic Test p-value:1.84E-13; Z-score:-3.51E+00

Methylation in Case

 6.37E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in breast cancer [ 2 ]

Location

 5'UTR (cg14215483)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:1.16E-06; Z-score:-1.30E+00

Methylation in Case

 8.07E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in breast cancer [ 2 ]

Location

 TSS1500 (cg06426831)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.31E+00 Statistic Test p-value:4.72E-08; Z-score:2.03E+00

Methylation in Case

 1.17E-01 (Median) Methylation in Control 8.91E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC35A3 in breast cancer [ 2 ]

Location

 TSS200 (cg00825462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:9.43E-03; Z-score:-5.04E-01

Methylation in Case

 6.10E-02 (Median) Methylation in Control 6.74E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC35A3 in breast cancer [ 2 ]

Location

 TSS200 (cg24599189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:2.17E-02; Z-score:-5.14E-01

Methylation in Case

 8.69E-02 (Median) Methylation in Control 9.57E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg09338170)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:1.92E-03; Z-score:8.29E-01

Methylation in Case

 2.23E-02 (Median) Methylation in Control 1.92E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg19499674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:4.80E-02; Z-score:-7.61E-01

Methylation in Case

 9.61E-01 (Median) Methylation in Control 9.67E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg20868668)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.48E+00 Statistic Test p-value:9.11E-04; Z-score:-2.29E+00

Methylation in Case

 2.23E-01 (Median) Methylation in Control 3.28E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC35A3 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg06426831)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.23E+00 Statistic Test p-value:9.32E-03; Z-score:1.20E+00

Methylation in Case

 6.23E-02 (Median) Methylation in Control 5.07E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC35A3 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg15502420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:2.99E-03; Z-score:5.36E-01

Methylation in Case

 5.15E-02 (Median) Methylation in Control 4.76E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC35A3 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg04102586)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:4.56E-03; Z-score:4.71E-01

Methylation in Case

 2.12E-02 (Median) Methylation in Control 2.02E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC35A3 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg00825462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:7.06E-03; Z-score:1.93E-01

Methylation in Case

 2.53E-02 (Median) Methylation in Control 2.42E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in colorectal cancer [ 4 ]

Location

 5'UTR (cg14215483)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:1.24E-06; Z-score:-1.62E+00

Methylation in Case

 7.09E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in colorectal cancer [ 4 ]

Location

 5'UTR (cg09993849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:8.65E-03; Z-score:-3.34E-01

Methylation in Case

 1.12E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg12909559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:1.81E-02; Z-score:-3.12E-01

Methylation in Case

 2.87E-02 (Median) Methylation in Control 3.18E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC35A3 in colorectal cancer [ 4 ]

Location

 TSS200 (cg00825462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:6.54E-03; Z-score:1.08E+00

Methylation in Case

 9.18E-02 (Median) Methylation in Control 8.17E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg19499674)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:8.06E-09; Z-score:-2.21E+00

Methylation in Case

 7.77E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg14215483)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:5.66E-07; Z-score:-1.34E+00

Methylation in Case

 7.75E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg27320127)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.74E+00 Statistic Test p-value:4.09E-13; Z-score:3.60E+00

Methylation in Case

 4.63E-01 (Median) Methylation in Control 2.66E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC35A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg06426831)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:2.23E-03; Z-score:-6.47E-01

Methylation in Case

 9.22E-02 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC35A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg20868668)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.20E+00 Statistic Test p-value:1.03E-02; Z-score:-7.08E-01

Methylation in Case

 1.42E-01 (Median) Methylation in Control 1.71E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC35A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg18313899)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:2.33E+00 Statistic Test p-value:1.35E-14; Z-score:5.50E+00

Methylation in Case

 3.76E-01 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC35A3 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg23337501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.32E+00 Statistic Test p-value:3.88E-12; Z-score:-5.30E+00

Methylation in Case

 6.64E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC35A3 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg01204634)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.27E+00 Statistic Test p-value:3.52E-12; Z-score:-4.83E+00

Methylation in Case

 6.32E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in panic disorder [ 6 ]

Location

 5'UTR (cg14215483)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-3.48E-01 Statistic Test p-value:1.65E-02; Z-score:-3.95E-01

Methylation in Case

 -2.43E-01 (Median) Methylation in Control -8.46E-02 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in panic disorder [ 6 ]

Location

 5'UTR (cg12738979)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:9.85E-01 Statistic Test p-value:4.55E-02; Z-score:3.23E-01

Methylation in Case

 -4.97E+00 (Median) Methylation in Control -5.05E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in panic disorder [ 6 ]

Location

 Body (cg22872634)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:6.42E-01 Statistic Test p-value:6.86E-07; Z-score:-8.19E-01

Methylation in Case

 -2.18E-01 (Median) Methylation in Control 1.40E-01 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in papillary thyroid cancer [ 7 ]

Location

 5'UTR (cg12738979)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:2.65E-03; Z-score:4.04E-01

Methylation in Case

 4.99E-02 (Median) Methylation in Control 4.71E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg00159212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:2.01E-02; Z-score:5.96E-01

Methylation in Case

 4.47E-02 (Median) Methylation in Control 4.10E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg24599189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:4.01E-02; Z-score:-4.53E-01

Methylation in Case

 6.81E-02 (Median) Methylation in Control 7.24E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in colon adenocarcinoma [ 8 ]

Location

 TSS1500 (cg00826767)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:1.10E-03; Z-score:-2.29E+00

Methylation in Case

 7.78E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in colon adenocarcinoma [ 8 ]

Location

 TSS1500 (cg20491914)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.30E+00 Statistic Test p-value:1.41E-03; Z-score:1.99E+00

Methylation in Case

 4.14E-01 (Median) Methylation in Control 3.19E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in colon adenocarcinoma [ 8 ]

Location

 1stExon (cg01338148)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:1.79E-04; Z-score:-3.72E+00

Methylation in Case

 7.32E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC35A3 in colon adenocarcinoma [ 8 ]

Location

 Body (cg12570419)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:3.33E-04; Z-score:-1.40E+00

Methylation in Case

 5.34E-01 (Median) Methylation in Control 5.92E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC35A3 in colon adenocarcinoma [ 8 ]

Location

 Body (cg16856453)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:4.89E-04; Z-score:1.45E+00

Methylation in Case

 5.24E-01 (Median) Methylation in Control 4.72E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC35A3 in colon adenocarcinoma [ 8 ]

Location

 Body (cg20822540)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:7.30E-04; Z-score:-1.17E+00

Methylation in Case

 6.42E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg20868668)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.25E+00 Statistic Test p-value:1.93E-02; Z-score:1.51E+00

Methylation in Case

 3.25E-01 (Median) Methylation in Control 2.59E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg06426831)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:2.52E-02; Z-score:1.68E+00

Methylation in Case

 1.53E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg00159212)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:2.54E-02; Z-score:1.36E+00

Methylation in Case

 8.14E-02 (Median) Methylation in Control 7.60E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC35A3 in lung adenocarcinoma [ 9 ]

Location

 Body (cg22872634)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:1.22E-02; Z-score:1.17E+00

Methylation in Case

 8.82E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS1500 (cg16244747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:1.92E-03; Z-score:8.32E-01

Methylation in Case

 9.10E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg02874016)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.13E+00 Statistic Test p-value:1.49E-13; Z-score:2.32E+00

Methylation in Case

 6.19E-01 (Median) Methylation in Control 5.49E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg21286402)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.18E+00 Statistic Test p-value:7.19E-03; Z-score:-6.03E-01

Methylation in Case

 9.31E-02 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A3 in prostate cancer [ 11 ]

Location

 Body (cg20816789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:1.51E-03; Z-score:3.43E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC35A3 in prostate cancer [ 11 ]

Location

 Body (cg24312105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.43E+00 Statistic Test p-value:1.16E-02; Z-score:2.51E+00

Methylation in Case

 7.84E-01 (Median) Methylation in Control 5.47E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC35A3 in prostate cancer [ 11 ]

Location

 Body (cg23091302)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.55E+00 Statistic Test p-value:4.92E-02; Z-score:-1.44E+00

Methylation in Case

 2.02E-01 (Median) Methylation in Control 3.13E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-1273c directly targets SLC35A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1273c miRNA Mature ID miR-1273c

miRNA Sequence

 GGCGACAAAACGAGACCCUGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-1292 directly targets SLC35A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1292 miRNA Mature ID miR-1292-3p

miRNA Sequence

 UCGCGCCCCGGCUCCCGUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-186 directly targets SLC35A3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-3p

miRNA Sequence

 GCCCAAAGGUGAAUUUUUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-3159 directly targets SLC35A3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3159 miRNA Mature ID miR-3159

miRNA Sequence

 UAGGAUUACAAGUGUCGGCCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-383 directly targets SLC35A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-383 miRNA Mature ID miR-383-3p

miRNA Sequence

 ACAGCACUGCCUGGUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-508 directly targets SLC35A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-508 miRNA Mature ID miR-508-5p

miRNA Sequence

 UACUCCAGAGGGCGUCACUCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-548av directly targets SLC35A3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548av miRNA Mature ID miR-548av-3p

miRNA Sequence

 AAAACUGCAGUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-6512 directly targets SLC35A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

 UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-6720 directly targets SLC35A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

 UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-6747 directly targets SLC35A3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon11

 miR-6778 directly targets SLC35A3 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

 UGCCUCCCUGACAUUCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-6849 directly targets SLC35A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

 ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-766 directly targets SLC35A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-766 miRNA Mature ID miR-766-3p

miRNA Sequence

 ACUCCAGCCCCACAGCCUCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
13 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.