General Information of Drug Transporter (DT)
DT ID DTD0288 Transporter Info
Gene Name SLC35A2
Transporter Name UDP-galactose translocator
Gene ID
7355
UniProt ID
P78381
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35A2 in bladder cancer [ 1 ]

Location

3'UTR (cg26807389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.05E-03; Z-score:-1.59E+00

Methylation in Case

7.98E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35A2 in colorectal cancer [ 2 ]

Location

3'UTR (cg26807389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:6.07E-09; Z-score:-1.53E+00

Methylation in Case

8.76E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC35A2 in hepatocellular carcinoma [ 3 ]

Location

3'UTR (cg26807389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.48E-02; Z-score:-1.82E-01

Methylation in Case

8.48E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pituitary adenoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC35A2 in pituitary adenoma than that in healthy individual

Studied Phenotype

Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.48E-06; Fold-change:-0.251224454; Z-score:-2.799256768
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Esthesioneuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC35A2 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.04E-17; Fold-change:-0.588672045; Z-score:-4.206368561
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-124 directly targets SLC35A2 [ 4 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

miR-222 directly targets SLC35A2 [ 5 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-222 miRNA Mature ID miR-222-3p

miRNA Sequence

AGCUACAUCUGGCUACUGGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-3657 directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3657 miRNA Mature ID miR-3657

miRNA Sequence

UGUGUCCCAUUAUUGGUGAUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-4669 directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4669 miRNA Mature ID miR-4669

miRNA Sequence

UGUGUCCGGGAAGUGGAGGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-4780 directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4780 miRNA Mature ID miR-4780

miRNA Sequence

ACCCUUGAGCCUGAUCCCUAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-581 directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-581 miRNA Mature ID miR-581

miRNA Sequence

UCUUGUGUUCUCUAGAUCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-592 directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-592 miRNA Mature ID miR-592

miRNA Sequence

UUGUGUCAAUAUGCGAUGAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-623 directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-623 miRNA Mature ID miR-623

miRNA Sequence

AUCCCUUGCAGGGGCUGUUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-6780b directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6780b miRNA Mature ID miR-6780b-3p

miRNA Sequence

UCCCUUGUCUCCUUUCCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-6865 directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6865 miRNA Mature ID miR-6865-3p

miRNA Sequence

ACACCCUCUUUCCCUACCGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-6887 directly targets SLC35A2 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6887 miRNA Mature ID miR-6887-3p

miRNA Sequence

UCCCCUCCACUUUCCUCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
5 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
6 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.