Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0288 Transporter Info
Gene Name SLC35A2
Transporter Name UDP-galactose translocator
Gene ID
7355
UniProt ID
P78381
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A2 in bladder cancer [ 1 ]

Location

 3'UTR (cg26807389)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:8.05E-03; Z-score:-1.59E+00

Methylation in Case

 7.98E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A2 in colorectal cancer [ 2 ]

Location

 3'UTR (cg26807389)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:6.07E-09; Z-score:-1.53E+00

Methylation in Case

 8.76E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC35A2 in hepatocellular carcinoma [ 3 ]

Location

 3'UTR (cg26807389)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:3.48E-02; Z-score:-1.82E-01

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Pituitary adenoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Moderate hypomethylation of SLC35A2 in pituitary adenoma than that in healthy individual

Studied Phenotype

 Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:4.48E-06; Fold-change:-0.251224454; Z-score:-2.799256768
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Esthesioneuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Significant hypomethylation of SLC35A2 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

 Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:9.04E-17; Fold-change:-0.588672045; Z-score:-4.206368561
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-124 directly targets SLC35A2 [ 4 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

 miR-222 directly targets SLC35A2 [ 5 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-222 miRNA Mature ID miR-222-3p

miRNA Sequence

 AGCUACAUCUGGCUACUGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

 miR-3657 directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3657 miRNA Mature ID miR-3657

miRNA Sequence

 UGUGUCCCAUUAUUGGUGAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-4669 directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4669 miRNA Mature ID miR-4669

miRNA Sequence

 UGUGUCCGGGAAGUGGAGGAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-4780 directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4780 miRNA Mature ID miR-4780

miRNA Sequence

 ACCCUUGAGCCUGAUCCCUAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-581 directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-581 miRNA Mature ID miR-581

miRNA Sequence

 UCUUGUGUUCUCUAGAUCAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-592 directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-592 miRNA Mature ID miR-592

miRNA Sequence

 UUGUGUCAAUAUGCGAUGAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-623 directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-623 miRNA Mature ID miR-623

miRNA Sequence

 AUCCCUUGCAGGGGCUGUUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-6780b directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6780b miRNA Mature ID miR-6780b-3p

miRNA Sequence

 UCCCUUGUCUCCUUUCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-6865 directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6865 miRNA Mature ID miR-6865-3p

miRNA Sequence

 ACACCCUCUUUCCCUACCGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon11

 miR-6887 directly targets SLC35A2 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6887 miRNA Mature ID miR-6887-3p

miRNA Sequence

 UCCCCUCCACUUUCCUCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
5 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
6 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.