Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0282 Transporter Info | ||||
Gene Name | SLC33A1 | ||||
Transporter Name | Acetyl-coenzyme A transporter 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Pancretic ductal adenocarcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
5'UTR (cg25003907) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:8.27E-03; Z-score:-7.19E-01 | ||
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 7.41E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC33A1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg13355704) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:5.76E-03; Z-score:-4.35E-01 | ||
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 1.56E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC33A1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
1stExon (cg16107172) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:4.30E-04; Z-score:1.30E+00 | ||
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC33A1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg21513991) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.64E-03; Z-score:6.49E-01 | ||
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC33A1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg19657603) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:5.81E-03; Z-score:1.01E-01 | ||
Methylation in Case |
5.07E-02 (Median) | Methylation in Control | 4.75E-02 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in bladder cancer | [ 2 ] | |||
Location |
TSS1500 (cg09452751) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:2.57E-02; Z-score:1.28E+00 | ||
Methylation in Case |
9.41E-02 (Median) | Methylation in Control | 8.22E-02 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC33A1 in bladder cancer | [ 2 ] | |||
Location |
Body (cg25375916) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:6.52E-06; Z-score:-5.38E+00 | ||
Methylation in Case |
4.89E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC33A1 in bladder cancer | [ 2 ] | |||
Location |
Body (cg15451248) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.73E+00 | Statistic Test | p-value:6.66E-06; Z-score:-4.44E+00 | ||
Methylation in Case |
3.62E-01 (Median) | Methylation in Control | 6.26E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC33A1 in bladder cancer | [ 2 ] | |||
Location |
Body (cg03876340) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:3.35E-05; Z-score:-3.37E+00 | ||
Methylation in Case |
3.85E-01 (Median) | Methylation in Control | 5.21E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in breast cancer | [ 3 ] | |||
Location |
TSS1500 (cg02868222) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:8.38E-03; Z-score:3.49E-01 | ||
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 1.62E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC33A1 in breast cancer | [ 3 ] | |||
Location |
TSS200 (cg12335906) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:3.17E-03; Z-score:-4.70E-01 | ||
Methylation in Case |
3.95E-02 (Median) | Methylation in Control | 4.67E-02 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC33A1 in breast cancer | [ 3 ] | |||
Location |
TSS200 (cg16579347) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.89E-02; Z-score:-3.04E-01 | ||
Methylation in Case |
5.08E-02 (Median) | Methylation in Control | 5.72E-02 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC33A1 in breast cancer | [ 3 ] | |||
Location |
Body (cg03876340) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.35E-02; Z-score:5.52E-01 | ||
Methylation in Case |
3.29E-01 (Median) | Methylation in Control | 2.97E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC33A1 in breast cancer | [ 3 ] | |||
Location |
3'UTR (cg11178666) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.89E-02; Z-score:-3.68E-01 | ||
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Renal cell carcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in clear cell renal cell carcinoma | [ 4 ] | |||
Location |
TSS1500 (cg02868222) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:3.85E-04; Z-score:1.16E+00 | ||
Methylation in Case |
2.40E-01 (Median) | Methylation in Control | 2.03E-01 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC33A1 in clear cell renal cell carcinoma | [ 4 ] | |||
Location |
TSS1500 (cg22572214) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:1.33E-02; Z-score:6.92E-01 | ||
Methylation in Case |
1.59E-02 (Median) | Methylation in Control | 1.42E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC33A1 in clear cell renal cell carcinoma | [ 4 ] | |||
Location |
TSS200 (cg05643110) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.48E-02; Z-score:2.26E-01 | ||
Methylation in Case |
3.15E-02 (Median) | Methylation in Control | 3.05E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC33A1 in clear cell renal cell carcinoma | [ 4 ] | |||
Location |
1stExon (cg21538020) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.49E-05; Z-score:8.45E-01 | ||
Methylation in Case |
2.39E-02 (Median) | Methylation in Control | 2.20E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC33A1 in clear cell renal cell carcinoma | [ 4 ] | |||
Location |
1stExon (cg14960293) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:7.12E-04; Z-score:9.98E-01 | ||
Methylation in Case |
3.26E-02 (Median) | Methylation in Control | 2.69E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC33A1 in clear cell renal cell carcinoma | [ 4 ] | |||
Location |
1stExon (cg22068985) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:7.98E-04; Z-score:4.18E-01 | ||
Methylation in Case |
2.28E-02 (Median) | Methylation in Control | 2.14E-02 (Median) | ||
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in colorectal cancer | [ 5 ] | |||
Location |
TSS1500 (cg02868222) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:3.51E-02; Z-score:-5.05E-01 | ||
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 1.60E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC33A1 in colorectal cancer | [ 5 ] | |||
Location |
TSS200 (cg05643110) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.40E-02; Z-score:3.59E-01 | ||
Methylation in Case |
9.81E-02 (Median) | Methylation in Control | 9.33E-02 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC33A1 in colorectal cancer | [ 5 ] | |||
Location |
TSS200 (cg16579347) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.90E-02; Z-score:-1.78E-01 | ||
Methylation in Case |
8.72E-02 (Median) | Methylation in Control | 9.03E-02 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC33A1 in colorectal cancer | [ 5 ] | |||
Location |
1stExon (cg14960293) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.80E-02; Z-score:2.48E-01 | ||
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 1.17E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC33A1 in colorectal cancer | [ 5 ] | |||
Location |
Body (cg25375916) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:3.34E-03; Z-score:-5.27E-01 | ||
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 6.04E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC33A1 in colorectal cancer | [ 5 ] | |||
Location |
3'UTR (cg11178666) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.95E-05; Z-score:-1.41E+00 | ||
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in hepatocellular carcinoma | [ 6 ] | |||
Location |
TSS1500 (cg07135388) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:3.22E+00 | Statistic Test | p-value:9.36E-11; Z-score:5.05E+00 | ||
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 4.02E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC33A1 in hepatocellular carcinoma | [ 6 ] | |||
Location |
1stExon (cg14960293) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.03E-03; Z-score:-3.65E-01 | ||
Methylation in Case |
7.74E-02 (Median) | Methylation in Control | 8.23E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC33A1 in hepatocellular carcinoma | [ 6 ] | |||
Location |
Body (cg15451248) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:3.74E-09; Z-score:-1.38E+00 | ||
Methylation in Case |
3.44E-01 (Median) | Methylation in Control | 4.98E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in panic disorder | [ 7 ] | |||
Location |
TSS1500 (cg02868222) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-9.11E-01 | Statistic Test | p-value:1.72E-02; Z-score:-3.36E-01 | ||
Methylation in Case |
-7.87E-01 (Median) | Methylation in Control | -7.17E-01 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in papillary thyroid cancer | [ 8 ] | |||
Location |
TSS1500 (cg22572214) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.00E-02; Z-score:-4.56E-01 | ||
Methylation in Case |
4.94E-02 (Median) | Methylation in Control | 5.44E-02 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC33A1 in papillary thyroid cancer | [ 8 ] | |||
Location |
TSS200 (cg16579347) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.54E-03; Z-score:-3.64E-01 | ||
Methylation in Case |
4.25E-02 (Median) | Methylation in Control | 4.59E-02 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC33A1 in papillary thyroid cancer | [ 8 ] | |||
Location |
TSS200 (cg12335906) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:9.01E-03; Z-score:-4.18E-01 | ||
Methylation in Case |
3.84E-02 (Median) | Methylation in Control | 4.12E-02 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC33A1 in papillary thyroid cancer | [ 8 ] | |||
Location |
Body (cg03876340) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:1.10E-02; Z-score:9.64E-01 | ||
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 5.21E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Colon cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in colon adenocarcinoma | [ 9 ] | |||
Location |
TSS200 (cg03419058) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:9.50E-06; Z-score:1.04E+00 | ||
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 5.57E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC33A1 in colon adenocarcinoma | [ 9 ] | |||
Location |
TSS200 (cg21557030) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.85E+00 | Statistic Test | p-value:1.64E-04; Z-score:3.06E+00 | ||
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 2.52E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC33A1 in colon adenocarcinoma | [ 9 ] | |||
Location |
Body (cg04954559) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.71E+00 | Statistic Test | p-value:9.06E-05; Z-score:2.14E+00 | ||
Methylation in Case |
4.48E-01 (Median) | Methylation in Control | 2.63E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC33A1 in colon adenocarcinoma | [ 9 ] | |||
Location |
Body (cg13739680) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.49E-04; Z-score:-1.78E+00 | ||
Methylation in Case |
5.10E-01 (Median) | Methylation in Control | 5.87E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC33A1 in colon adenocarcinoma | [ 9 ] | |||
Location |
Body (cg02707854) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:2.05E-03; Z-score:-1.16E+00 | ||
Methylation in Case |
3.05E-01 (Median) | Methylation in Control | 4.27E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC33A1 in colon adenocarcinoma | [ 9 ] | |||
Location |
3'UTR (cg04223222) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.21E-03; Z-score:-1.31E+00 | ||
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC33A1 in lung adenocarcinoma | [ 10 ] | |||
Location |
Body (cg25375916) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:3.73E-02; Z-score:-2.03E+00 | ||
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 6.19E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
53 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
let-7f directly targets SLC33A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
let-7f | miRNA Mature ID | let-7f-5p | ||
miRNA Sequence |
UGAGGUAGUAGAUUGUAUAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon2 |
miR-1262 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1262 | miRNA Mature ID | miR-1262 | ||
miRNA Sequence |
AUGGGUGAAUUUGUAGAAGGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon3 |
miR-150 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-150 | miRNA Mature ID | miR-150-5p | ||
miRNA Sequence |
UCUCCCAACCCUUGUACCAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-153 directly targets SLC33A1 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-153 | miRNA Mature ID | miR-153-5p | ||
miRNA Sequence |
UCAUUUUUGUGAUGUUGCAGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon5 |
miR-186 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-3p | ||
miRNA Sequence |
GCCCAAAGGUGAAUUUUUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-1908 directly targets SLC33A1 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1908 | miRNA Mature ID | miR-1908-3p | ||
miRNA Sequence |
CCGGCCGCCGGCUCCGCCCCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon7 |
miR-24 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-25 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-25 | miRNA Mature ID | miR-25-3p | ||
miRNA Sequence |
CAUUGCACUUGUCUCGGUCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon9 |
miR-30a directly targets SLC33A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-5p | ||
miRNA Sequence |
UGUAAACAUCCUCGACUGGAAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon10 |
miR-3129 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3129 | miRNA Mature ID | miR-3129-3p | ||
miRNA Sequence |
AAACUAAUCUCUACACUGCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon11 |
miR-3145 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3145 | miRNA Mature ID | miR-3145-5p | ||
miRNA Sequence |
AACUCCAAACACUCAAAACUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon12 |
miR-3199 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3199 | miRNA Mature ID | miR-3199 | ||
miRNA Sequence |
AGGGACUGCCUUAGGAGAAAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon13 |
miR-32 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-32 | miRNA Mature ID | miR-32-5p | ||
miRNA Sequence |
UAUUGCACAUUACUAAGUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon14 |
miR-335 directly targets SLC33A1 | [ 16 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon15 |
miR-363 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-363 | miRNA Mature ID | miR-363-3p | ||
miRNA Sequence |
AAUUGCACGGUAUCCAUCUGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon16 |
miR-365a directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-365a | miRNA Mature ID | miR-365a-5p | ||
miRNA Sequence |
AGGGACUUUUGGGGGCAGAUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon17 |
miR-365b directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-365b | miRNA Mature ID | miR-365b-5p | ||
miRNA Sequence |
AGGGACUUUCAGGGGCAGCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon18 |
miR-367 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-367 | miRNA Mature ID | miR-367-3p | ||
miRNA Sequence |
AAUUGCACUUUAGCAAUGGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon19 |
miR-383 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-383 | miRNA Mature ID | miR-383-3p | ||
miRNA Sequence |
ACAGCACUGCCUGGUCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon20 |
miR-4266 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4266 | miRNA Mature ID | miR-4266 | ||
miRNA Sequence |
CUAGGAGGCCUUGGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon21 |
miR-4284 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4284 | miRNA Mature ID | miR-4284 | ||
miRNA Sequence |
GGGCUCACAUCACCCCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon22 |
miR-4499 directly targets SLC33A1 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4499 | miRNA Mature ID | miR-4499 | ||
miRNA Sequence |
AAGACUGAGAGGAGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon23 |
miR-4506 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4506 | miRNA Mature ID | miR-4506 | ||
miRNA Sequence |
AAAUGGGUGGUCUGAGGCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon24 |
miR-4537 directly targets SLC33A1 | [ 17 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4537 | miRNA Mature ID | miR-4537 | ||
miRNA Sequence |
UGAGCCGAGCUGAGCUUAGCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon25 |
miR-455 directly targets SLC33A1 | [ 17 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-455 | miRNA Mature ID | miR-455-3p | ||
miRNA Sequence |
GCAGUCCAUGGGCAUAUACAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon26 |
miR-4695 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4695 | miRNA Mature ID | miR-4695-5p | ||
miRNA Sequence |
CAGGAGGCAGUGGGCGAGCAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon27 |
miR-4701 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-3p | ||
miRNA Sequence |
AUGGGUGAUGGGUGUGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon28 |
miR-4779 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4779 | miRNA Mature ID | miR-4779 | ||
miRNA Sequence |
UAGGAGGGAAUAGUAAAAGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon29 |
miR-500a directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-500a | miRNA Mature ID | miR-500a-3p | ||
miRNA Sequence |
AUGCACCUGGGCAAGGAUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon30 |
miR-503 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-503 | miRNA Mature ID | miR-503-5p | ||
miRNA Sequence |
UAGCAGCGGGAACAGUUCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon31 |
miR-508 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-508 | miRNA Mature ID | miR-508-5p | ||
miRNA Sequence |
UACUCCAGAGGGCGUCACUCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon32 |
miR-5186 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5186 | miRNA Mature ID | miR-5186 | ||
miRNA Sequence |
AGAGAUUGGUAGAAAUCAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon33 |
miR-5583 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5583 | miRNA Mature ID | miR-5583-5p | ||
miRNA Sequence |
AAACUAAUAUACCCAUAUUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon34 |
miR-651 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-651 | miRNA Mature ID | miR-651-5p | ||
miRNA Sequence |
UUUAGGAUAAGCUUGACUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon35 |
miR-6512 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6512 | miRNA Mature ID | miR-6512-3p | ||
miRNA Sequence |
UUCCAGCCCUUCUAAUGGUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon36 |
miR-6516 directly targets SLC33A1 | [ 17 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6516 | miRNA Mature ID | miR-6516-5p | ||
miRNA Sequence |
UUUGCAGUAACAGGUGUGAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon37 |
miR-661 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-661 | miRNA Mature ID | miR-661 | ||
miRNA Sequence |
UGCCUGGGUCUCUGGCCUGCGCGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon38 |
miR-6720 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6720 | miRNA Mature ID | miR-6720-5p | ||
miRNA Sequence |
UUCCAGCCCUGGUAGGCGCCGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon39 |
miR-6736 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6736 | miRNA Mature ID | miR-6736-5p | ||
miRNA Sequence |
CUGGGUGAGGGCAUCUGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon40 |
miR-6742 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6742 | miRNA Mature ID | miR-6742-3p | ||
miRNA Sequence |
ACCUGGGUUGUCCCCUCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon41 |
miR-6747 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6747 | miRNA Mature ID | miR-6747-3p | ||
miRNA Sequence |
UCCUGCCUUCCUCUGCACCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon42 |
miR-6776 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6776 | miRNA Mature ID | miR-6776-5p | ||
miRNA Sequence |
UCUGGGUGCAGUGGGGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon43 |
miR-6778 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-3p | ||
miRNA Sequence |
UGCCUCCCUGACAUUCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon44 |
miR-6849 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6849 | miRNA Mature ID | miR-6849-3p | ||
miRNA Sequence |
ACCAGCCUGUGUCCACCUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon45 |
miR-6850 directly targets SLC33A1 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6850 | miRNA Mature ID | miR-6850-3p | ||
miRNA Sequence |
CCCGGCCGGAACGCCGCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon46 |
miR-6857 directly targets SLC33A1 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6857 | miRNA Mature ID | miR-6857-3p | ||
miRNA Sequence |
UGACUGAGCUUCUCCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon47 |
miR-7109 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7109 | miRNA Mature ID | miR-7109-3p | ||
miRNA Sequence |
CAAGCCUCUCCUGCCCUUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon48 |
miR-766 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-766 | miRNA Mature ID | miR-766-3p | ||
miRNA Sequence |
ACUCCAGCCCCACAGCCUCAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon49 |
miR-767 directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-767 | miRNA Mature ID | miR-767-5p | ||
miRNA Sequence |
UGCACCAUGGUUGUCUGAGCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon50 |
miR-7977 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7977 | miRNA Mature ID | miR-7977 | ||
miRNA Sequence |
UUCCCAGCCAACGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon51 |
miR-8052 directly targets SLC33A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8052 | miRNA Mature ID | miR-8052 | ||
miRNA Sequence |
CGGGACUGUAGAGGGCAUGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon52 |
miR-92a directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon53 |
miR-92b directly targets SLC33A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-3p | ||
miRNA Sequence |
UAUUGCACUCGUCCCGGCCUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.