Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0282 Transporter Info
Gene Name	SLC33A1
Transporter Name	Acetyl-coenzyme A transporter 1
Gene ID	9197
UniProt ID	O00400

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg25003907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:8.27E-03; Z-score:-7.19E-01
Methylation in Case	7.09E-01 (Median)	Methylation in Control	7.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC33A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg13355704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:5.76E-03; Z-score:-4.35E-01
Methylation in Case	1.25E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC33A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	1stExon (cg16107172)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:4.30E-04; Z-score:1.30E+00
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC33A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg21513991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.64E-03; Z-score:6.49E-01
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC33A1 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg19657603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:5.81E-03; Z-score:1.01E-01
Methylation in Case	5.07E-02 (Median)	Methylation in Control	4.75E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg09452751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:2.57E-02; Z-score:1.28E+00
Methylation in Case	9.41E-02 (Median)	Methylation in Control	8.22E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC33A1 in bladder cancer			[ 2 ]
Location	Body (cg25375916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:6.52E-06; Z-score:-5.38E+00
Methylation in Case	4.89E-01 (Median)	Methylation in Control	6.65E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC33A1 in bladder cancer			[ 2 ]
Location	Body (cg15451248)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.73E+00	Statistic Test	p-value:6.66E-06; Z-score:-4.44E+00
Methylation in Case	3.62E-01 (Median)	Methylation in Control	6.26E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC33A1 in bladder cancer			[ 2 ]
Location	Body (cg03876340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:3.35E-05; Z-score:-3.37E+00
Methylation in Case	3.85E-01 (Median)	Methylation in Control	5.21E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg02868222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:8.38E-03; Z-score:3.49E-01
Methylation in Case	1.86E-01 (Median)	Methylation in Control	1.62E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC33A1 in breast cancer			[ 3 ]
Location	TSS200 (cg12335906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:3.17E-03; Z-score:-4.70E-01
Methylation in Case	3.95E-02 (Median)	Methylation in Control	4.67E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC33A1 in breast cancer			[ 3 ]
Location	TSS200 (cg16579347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.89E-02; Z-score:-3.04E-01
Methylation in Case	5.08E-02 (Median)	Methylation in Control	5.72E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC33A1 in breast cancer			[ 3 ]
Location	Body (cg03876340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:2.35E-02; Z-score:5.52E-01
Methylation in Case	3.29E-01 (Median)	Methylation in Control	2.97E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC33A1 in breast cancer			[ 3 ]
Location	3'UTR (cg11178666)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.89E-02; Z-score:-3.68E-01
Methylation in Case	6.80E-01 (Median)	Methylation in Control	7.01E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg02868222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:3.85E-04; Z-score:1.16E+00
Methylation in Case	2.40E-01 (Median)	Methylation in Control	2.03E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC33A1 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg22572214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:1.33E-02; Z-score:6.92E-01
Methylation in Case	1.59E-02 (Median)	Methylation in Control	1.42E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC33A1 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg05643110)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.48E-02; Z-score:2.26E-01
Methylation in Case	3.15E-02 (Median)	Methylation in Control	3.05E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC33A1 in clear cell renal cell carcinoma			[ 4 ]
Location	1stExon (cg21538020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.49E-05; Z-score:8.45E-01
Methylation in Case	2.39E-02 (Median)	Methylation in Control	2.20E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC33A1 in clear cell renal cell carcinoma			[ 4 ]
Location	1stExon (cg14960293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:7.12E-04; Z-score:9.98E-01
Methylation in Case	3.26E-02 (Median)	Methylation in Control	2.69E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC33A1 in clear cell renal cell carcinoma			[ 4 ]
Location	1stExon (cg22068985)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:7.98E-04; Z-score:4.18E-01
Methylation in Case	2.28E-02 (Median)	Methylation in Control	2.14E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg02868222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:3.51E-02; Z-score:-5.05E-01
Methylation in Case	1.30E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC33A1 in colorectal cancer			[ 5 ]
Location	TSS200 (cg05643110)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:1.40E-02; Z-score:3.59E-01
Methylation in Case	9.81E-02 (Median)	Methylation in Control	9.33E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC33A1 in colorectal cancer			[ 5 ]
Location	TSS200 (cg16579347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:4.90E-02; Z-score:-1.78E-01
Methylation in Case	8.72E-02 (Median)	Methylation in Control	9.03E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC33A1 in colorectal cancer			[ 5 ]
Location	1stExon (cg14960293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:4.80E-02; Z-score:2.48E-01
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC33A1 in colorectal cancer			[ 5 ]
Location	Body (cg25375916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.34E-03; Z-score:-5.27E-01
Methylation in Case	5.58E-01 (Median)	Methylation in Control	6.04E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC33A1 in colorectal cancer			[ 5 ]
Location	3'UTR (cg11178666)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.95E-05; Z-score:-1.41E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg07135388)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.22E+00	Statistic Test	p-value:9.36E-11; Z-score:5.05E+00
Methylation in Case	1.30E-01 (Median)	Methylation in Control	4.02E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC33A1 in hepatocellular carcinoma			[ 6 ]
Location	1stExon (cg14960293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.03E-03; Z-score:-3.65E-01
Methylation in Case	7.74E-02 (Median)	Methylation in Control	8.23E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC33A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg15451248)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.45E+00	Statistic Test	p-value:3.74E-09; Z-score:-1.38E+00
Methylation in Case	3.44E-01 (Median)	Methylation in Control	4.98E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in panic disorder			[ 7 ]
Location	TSS1500 (cg02868222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.11E-01	Statistic Test	p-value:1.72E-02; Z-score:-3.36E-01
Methylation in Case	-7.87E-01 (Median)	Methylation in Control	-7.17E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in papillary thyroid cancer			[ 8 ]
Location	TSS1500 (cg22572214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:3.00E-02; Z-score:-4.56E-01
Methylation in Case	4.94E-02 (Median)	Methylation in Control	5.44E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC33A1 in papillary thyroid cancer			[ 8 ]
Location	TSS200 (cg16579347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:2.54E-03; Z-score:-3.64E-01
Methylation in Case	4.25E-02 (Median)	Methylation in Control	4.59E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC33A1 in papillary thyroid cancer			[ 8 ]
Location	TSS200 (cg12335906)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:9.01E-03; Z-score:-4.18E-01
Methylation in Case	3.84E-02 (Median)	Methylation in Control	4.12E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC33A1 in papillary thyroid cancer			[ 8 ]
Location	Body (cg03876340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.10E-02; Z-score:9.64E-01
Methylation in Case	5.88E-01 (Median)	Methylation in Control	5.21E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in colon adenocarcinoma			[ 9 ]
Location	TSS200 (cg03419058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:9.50E-06; Z-score:1.04E+00
Methylation in Case	7.01E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC33A1 in colon adenocarcinoma			[ 9 ]
Location	TSS200 (cg21557030)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.85E+00	Statistic Test	p-value:1.64E-04; Z-score:3.06E+00
Methylation in Case	4.65E-01 (Median)	Methylation in Control	2.52E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC33A1 in colon adenocarcinoma			[ 9 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.71E+00	Statistic Test	p-value:9.06E-05; Z-score:2.14E+00
Methylation in Case	4.48E-01 (Median)	Methylation in Control	2.63E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC33A1 in colon adenocarcinoma			[ 9 ]
Location	Body (cg13739680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:1.49E-04; Z-score:-1.78E+00
Methylation in Case	5.10E-01 (Median)	Methylation in Control	5.87E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC33A1 in colon adenocarcinoma			[ 9 ]
Location	Body (cg02707854)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:2.05E-03; Z-score:-1.16E+00
Methylation in Case	3.05E-01 (Median)	Methylation in Control	4.27E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC33A1 in colon adenocarcinoma			[ 9 ]
Location	3'UTR (cg04223222)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.21E-03; Z-score:-1.31E+00
Methylation in Case	8.60E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC33A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg25375916)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:3.73E-02; Z-score:-2.03E+00
Methylation in Case	4.77E-01 (Median)	Methylation in Control	6.19E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	53 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	let-7f directly targets SLC33A1			[ 11 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	let-7f	miRNA Mature ID	let-7f-5p
miRNA Sequence	UGAGGUAGUAGAUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon2	miR-1262 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1262	miRNA Mature ID	miR-1262
miRNA Sequence	AUGGGUGAAUUUGUAGAAGGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon3	miR-150 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-150	miRNA Mature ID	miR-150-5p
miRNA Sequence	UCUCCCAACCCUUGUACCAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-153 directly targets SLC33A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-153	miRNA Mature ID	miR-153-5p
miRNA Sequence	UCAUUUUUGUGAUGUUGCAGCU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon5	miR-186 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-3p
miRNA Sequence	GCCCAAAGGUGAAUUUUUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-1908 directly targets SLC33A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1908	miRNA Mature ID	miR-1908-3p
miRNA Sequence	CCGGCCGCCGGCUCCGCCCCG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon7	miR-24 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-24	miRNA Mature ID	miR-24-3p
miRNA Sequence	UGGCUCAGUUCAGCAGGAACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-25 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-25	miRNA Mature ID	miR-25-3p
miRNA Sequence	CAUUGCACUUGUCUCGGUCUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon9	miR-30a directly targets SLC33A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	Proteomics
miRNA Stemloop ID	miR-30a	miRNA Mature ID	miR-30a-5p
miRNA Sequence	UGUAAACAUCCUCGACUGGAAG
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon10	miR-3129 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3129	miRNA Mature ID	miR-3129-3p
miRNA Sequence	AAACUAAUCUCUACACUGCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-3145 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3145	miRNA Mature ID	miR-3145-5p
miRNA Sequence	AACUCCAAACACUCAAAACUCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon12	miR-3199 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3199	miRNA Mature ID	miR-3199
miRNA Sequence	AGGGACUGCCUUAGGAGAAAGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-32 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-32	miRNA Mature ID	miR-32-5p
miRNA Sequence	UAUUGCACAUUACUAAGUUGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon14	miR-335 directly targets SLC33A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-363 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-363	miRNA Mature ID	miR-363-3p
miRNA Sequence	AAUUGCACGGUAUCCAUCUGUA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon16	miR-365a directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-365a	miRNA Mature ID	miR-365a-5p
miRNA Sequence	AGGGACUUUUGGGGGCAGAUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-365b directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-365b	miRNA Mature ID	miR-365b-5p
miRNA Sequence	AGGGACUUUCAGGGGCAGCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-367 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-367	miRNA Mature ID	miR-367-3p
miRNA Sequence	AAUUGCACUUUAGCAAUGGUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon19	miR-383 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-383	miRNA Mature ID	miR-383-3p
miRNA Sequence	ACAGCACUGCCUGGUCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-4266 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4266	miRNA Mature ID	miR-4266
miRNA Sequence	CUAGGAGGCCUUGGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-4284 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4284	miRNA Mature ID	miR-4284
miRNA Sequence	GGGCUCACAUCACCCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-4499 directly targets SLC33A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4499	miRNA Mature ID	miR-4499
miRNA Sequence	AAGACUGAGAGGAGGGA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon23	miR-4506 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4506	miRNA Mature ID	miR-4506
miRNA Sequence	AAAUGGGUGGUCUGAGGCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-4537 directly targets SLC33A1			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4537	miRNA Mature ID	miR-4537
miRNA Sequence	UGAGCCGAGCUGAGCUUAGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-455 directly targets SLC33A1			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-455	miRNA Mature ID	miR-455-3p
miRNA Sequence	GCAGUCCAUGGGCAUAUACAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-4695 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4695	miRNA Mature ID	miR-4695-5p
miRNA Sequence	CAGGAGGCAGUGGGCGAGCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-4701 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4701	miRNA Mature ID	miR-4701-3p
miRNA Sequence	AUGGGUGAUGGGUGUGGUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon28	miR-4779 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4779	miRNA Mature ID	miR-4779
miRNA Sequence	UAGGAGGGAAUAGUAAAAGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-500a directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-500a	miRNA Mature ID	miR-500a-3p
miRNA Sequence	AUGCACCUGGGCAAGGAUUCUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon30	miR-503 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-503	miRNA Mature ID	miR-503-5p
miRNA Sequence	UAGCAGCGGGAACAGUUCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-508 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-508	miRNA Mature ID	miR-508-5p
miRNA Sequence	UACUCCAGAGGGCGUCACUCAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon32	miR-5186 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5186	miRNA Mature ID	miR-5186
miRNA Sequence	AGAGAUUGGUAGAAAUCAGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon33	miR-5583 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5583	miRNA Mature ID	miR-5583-5p
miRNA Sequence	AAACUAAUAUACCCAUAUUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-651 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-651	miRNA Mature ID	miR-651-5p
miRNA Sequence	UUUAGGAUAAGCUUGACUUUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-6512 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6512	miRNA Mature ID	miR-6512-3p
miRNA Sequence	UUCCAGCCCUUCUAAUGGUAGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon36	miR-6516 directly targets SLC33A1			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6516	miRNA Mature ID	miR-6516-5p
miRNA Sequence	UUUGCAGUAACAGGUGUGAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-661 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-661	miRNA Mature ID	miR-661
miRNA Sequence	UGCCUGGGUCUCUGGCCUGCGCGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon38	miR-6720 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6720	miRNA Mature ID	miR-6720-5p
miRNA Sequence	UUCCAGCCCUGGUAGGCGCCGCG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon39	miR-6736 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6736	miRNA Mature ID	miR-6736-5p
miRNA Sequence	CUGGGUGAGGGCAUCUGUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon40	miR-6742 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6742	miRNA Mature ID	miR-6742-3p
miRNA Sequence	ACCUGGGUUGUCCCCUCUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon41	miR-6747 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6747	miRNA Mature ID	miR-6747-3p
miRNA Sequence	UCCUGCCUUCCUCUGCACCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-6776 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6776	miRNA Mature ID	miR-6776-5p
miRNA Sequence	UCUGGGUGCAGUGGGGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon43	miR-6778 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6778	miRNA Mature ID	miR-6778-3p
miRNA Sequence	UGCCUCCCUGACAUUCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon44	miR-6849 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6849	miRNA Mature ID	miR-6849-3p
miRNA Sequence	ACCAGCCUGUGUCCACCUCCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon45	miR-6850 directly targets SLC33A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6850	miRNA Mature ID	miR-6850-3p
miRNA Sequence	CCCGGCCGGAACGCCGCACU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon46	miR-6857 directly targets SLC33A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6857	miRNA Mature ID	miR-6857-3p
miRNA Sequence	UGACUGAGCUUCUCCCCACAG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon47	miR-7109 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7109	miRNA Mature ID	miR-7109-3p
miRNA Sequence	CAAGCCUCUCCUGCCCUUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon48	miR-766 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-3p
miRNA Sequence	ACUCCAGCCCCACAGCCUCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon49	miR-767 directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-767	miRNA Mature ID	miR-767-5p
miRNA Sequence	UGCACCAUGGUUGUCUGAGCAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon50	miR-7977 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7977	miRNA Mature ID	miR-7977
miRNA Sequence	UUCCCAGCCAACGCACCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon51	miR-8052 directly targets SLC33A1			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8052	miRNA Mature ID	miR-8052
miRNA Sequence	CGGGACUGUAGAGGGCAUGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon52	miR-92a directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-92a	miRNA Mature ID	miR-92a-3p
miRNA Sequence	UAUUGCACUUGUCCCGGCCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon53	miR-92b directly targets SLC33A1			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-92b	miRNA Mature ID	miR-92b-3p
miRNA Sequence	UAUUGCACUCGUCCCGGCCUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
12	Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing. Genome Biol. 2013 May 26;14(5):R45.
13	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
14	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
15	Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
16	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
17	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence