General Information of Drug Transporter (DT)
DT ID DTD0274 Transporter Info
Gene Name SLC30A5
Transporter Name Zinc transporter 5
Gene ID
64924
UniProt ID
Q8TAD4
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A5 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg25367206)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:2.03E-10; Z-score:-4.01E+00

Methylation in Case

7.95E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A5 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg08918057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:8.64E-03; Z-score:3.51E-01

Methylation in Case

1.14E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A5 in bladder cancer [ 3 ]

Location

Body (cg08918057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.52E-03; Z-score:2.90E+00

Methylation in Case

8.03E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A5 in lung adenocarcinoma [ 4 ]

Location

Body (cg08918057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.99E-02; Z-score:1.79E+00

Methylation in Case

8.43E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         43 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-101 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-101 miRNA Mature ID miR-101-3p

miRNA Sequence

UACAGUACUGUGAUAACUGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-105 directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-105 miRNA Mature ID miR-105-5p

miRNA Sequence

UCAAAUGCUCAGACUCCUGUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1178 directly targets SLC30A5 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1178 miRNA Mature ID miR-1178-3p

miRNA Sequence

UUGCUCACUGUUCUUCCCUAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-1228 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1228 miRNA Mature ID miR-1228-3p

miRNA Sequence

UCACACCUGCCUCGCCCCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-1247 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1247 miRNA Mature ID miR-1247-3p

miRNA Sequence

CCCCGGGAACGUCGAGACUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1281 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1281 miRNA Mature ID miR-1281

miRNA Sequence

UCGCCUCCUCCUCUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-135a directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-135a miRNA Mature ID miR-135a-3p

miRNA Sequence

UAUAGGGAUUGGAGCCGUGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-1976 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-218 directly targets SLC30A5 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-31 directly targets SLC30A5 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-31 miRNA Mature ID miR-31-3p

miRNA Sequence

UGCUAUGCCAACAUAUUGCCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

miR-33a directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-33a miRNA Mature ID miR-33a-3p

miRNA Sequence

CAAUGUUUCCACAGUGCAUCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-361 directly targets SLC30A5 [ 10 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-361 miRNA Mature ID miR-361-5p

miRNA Sequence

UUAUCAGAAUCUCCAGGGGUAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

miR-3674 directly targets SLC30A5 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3674 miRNA Mature ID miR-3674

miRNA Sequence

AUUGUAGAACCUAAGAUUGGCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

miR-3689d directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

miR-377 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-377 miRNA Mature ID miR-377-3p

miRNA Sequence

AUCACACAAAGGCAACUUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-3907 directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3907 miRNA Mature ID miR-3907

miRNA Sequence

AGGUGCUCCAGGCUGGCUCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-3934 directly targets SLC30A5 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3934 miRNA Mature ID miR-3934-3p

miRNA Sequence

UGCUCAGGUUGCACAGCUGGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-4279 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

CUCUCCUCCCGGCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-4485 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4485 miRNA Mature ID miR-4485-5p

miRNA Sequence

ACCGCCUGCCCAGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-4722 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-4732 directly targets SLC30A5 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4732 miRNA Mature ID miR-4732-5p

miRNA Sequence

UGUAGAGCAGGGAGCAGGAAGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

miR-4735 directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4735 miRNA Mature ID miR-4735-3p

miRNA Sequence

AAAGGUGCUCAAAUUAGACAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-4772 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4772 miRNA Mature ID miR-4772-3p

miRNA Sequence

CCUGCAACUUUGCCUGAUCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-4781 directly targets SLC30A5 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4781 miRNA Mature ID miR-4781-3p

miRNA Sequence

AAUGUUGGAAUCCUCGCUAGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

miR-503 directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-503 miRNA Mature ID miR-503-3p

miRNA Sequence

GGGGUAUUGUUUCCGCUGCCAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-582 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-582 miRNA Mature ID miR-582-5p

miRNA Sequence

UUACAGUUGUUCAACCAGUUACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-6134 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

UGAGGUGGUAGGAUGUAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-655 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-655 miRNA Mature ID miR-655-5p

miRNA Sequence

AGAGGUUAUCCGUGUUAUGUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

miR-665 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-6727 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

UCCUGCCACCUCCUCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-6747 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-6755 directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6755 miRNA Mature ID miR-6755-5p

miRNA Sequence

UAGGGUAGACACUGACAACGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-6778 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

UGCCUCCCUGACAUUCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-6807 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon35

miR-6832 directly targets SLC30A5 [ 7 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6832 miRNA Mature ID miR-6832-5p

miRNA Sequence

AGUAGAGAGGAAAAGUUAGGGUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon36

miR-6840 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6840 miRNA Mature ID miR-6840-3p

miRNA Sequence

GCCCAGGACUUUGUGCGGGGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon37

miR-6841 directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6841 miRNA Mature ID miR-6841-5p

miRNA Sequence

UAGGGUACUCAGAGCAAGUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-6851 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

miR-6880 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6880 miRNA Mature ID miR-6880-5p

miRNA Sequence

UGGUGGAGGAAGAGGGCAGCUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

miR-6890 directly targets SLC30A5 [ 8 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

CCACUGCCUAUGCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-7158 directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7158 miRNA Mature ID miR-7158-5p

miRNA Sequence

GGCUCAAUCUCUGGUCCUGCAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-7847 directly targets SLC30A5 [ 5 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7847 miRNA Mature ID miR-7847-3p

miRNA Sequence

CGUGGAGGACGAGGAGGAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

miR-7853 directly targets SLC30A5 [ 6 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7853 miRNA Mature ID miR-7853-5p

miRNA Sequence

UCAAAUGCAGAUCCUGACUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
6 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
7 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
8 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
9 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
10 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.