Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0274 Transporter Info
Gene Name SLC30A5
Transporter Name Zinc transporter 5
Gene ID
64924
UniProt ID
Q8TAD4
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A5 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg25367206)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:2.03E-10; Z-score:-4.01E+00

Methylation in Case

 7.95E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A5 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 Body (cg08918057)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.04E+00 Statistic Test p-value:8.64E-03; Z-score:3.51E-01

Methylation in Case

 1.14E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A5 in bladder cancer [ 3 ]

Location

 Body (cg08918057)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:4.52E-03; Z-score:2.90E+00

Methylation in Case

 8.03E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A5 in lung adenocarcinoma [ 4 ]

Location

 Body (cg08918057)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:3.99E-02; Z-score:1.79E+00

Methylation in Case

 8.43E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          43 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-101 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-101 miRNA Mature ID miR-101-3p

miRNA Sequence

 UACAGUACUGUGAUAACUGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

 miR-105 directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-105 miRNA Mature ID miR-105-5p

miRNA Sequence

 UCAAAUGCUCAGACUCCUGUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-1178 directly targets SLC30A5 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1178 miRNA Mature ID miR-1178-3p

miRNA Sequence

 UUGCUCACUGUUCUUCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

 miR-1228 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1228 miRNA Mature ID miR-1228-3p

miRNA Sequence

 UCACACCUGCCUCGCCCCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-1247 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1247 miRNA Mature ID miR-1247-3p

miRNA Sequence

 CCCCGGGAACGUCGAGACUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-1281 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1281 miRNA Mature ID miR-1281

miRNA Sequence

 UCGCCUCCUCCUCUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-135a directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-135a miRNA Mature ID miR-135a-3p

miRNA Sequence

 UAUAGGGAUUGGAGCCGUGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-1976 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

 CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-218 directly targets SLC30A5 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

 UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-31 directly targets SLC30A5 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-31 miRNA Mature ID miR-31-3p

miRNA Sequence

 UGCUAUGCCAACAUAUUGCCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

 miR-33a directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-33a miRNA Mature ID miR-33a-3p

miRNA Sequence

 CAAUGUUUCCACAGUGCAUCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-361 directly targets SLC30A5 [ 10 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-361 miRNA Mature ID miR-361-5p

miRNA Sequence

 UUAUCAGAAUCUCCAGGGGUAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

 miR-3674 directly targets SLC30A5 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3674 miRNA Mature ID miR-3674

miRNA Sequence

 AUUGUAGAACCUAAGAUUGGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

 miR-3689d directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

 GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

 miR-377 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-377 miRNA Mature ID miR-377-3p

miRNA Sequence

 AUCACACAAAGGCAACUUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-3907 directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3907 miRNA Mature ID miR-3907

miRNA Sequence

 AGGUGCUCCAGGCUGGCUCACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon17

 miR-3934 directly targets SLC30A5 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3934 miRNA Mature ID miR-3934-3p

miRNA Sequence

 UGCUCAGGUUGCACAGCUGGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

 miR-4279 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

 CUCUCCUCCCGGCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon19

 miR-4485 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4485 miRNA Mature ID miR-4485-5p

miRNA Sequence

 ACCGCCUGCCCAGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon20

 miR-4722 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

 ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon21

 miR-4732 directly targets SLC30A5 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4732 miRNA Mature ID miR-4732-5p

miRNA Sequence

 UGUAGAGCAGGGAGCAGGAAGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

 miR-4735 directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4735 miRNA Mature ID miR-4735-3p

miRNA Sequence

 AAAGGUGCUCAAAUUAGACAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon23

 miR-4772 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4772 miRNA Mature ID miR-4772-3p

miRNA Sequence

 CCUGCAACUUUGCCUGAUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon24

 miR-4781 directly targets SLC30A5 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4781 miRNA Mature ID miR-4781-3p

miRNA Sequence

 AAUGUUGGAAUCCUCGCUAGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

 miR-503 directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-503 miRNA Mature ID miR-503-3p

miRNA Sequence

 GGGGUAUUGUUUCCGCUGCCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon26

 miR-582 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-582 miRNA Mature ID miR-582-5p

miRNA Sequence

 UUACAGUUGUUCAACCAGUUACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

 miR-6134 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

 UGAGGUGGUAGGAUGUAGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

 miR-655 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-655 miRNA Mature ID miR-655-5p

miRNA Sequence

 AGAGGUUAUCCGUGUUAUGUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

 miR-665 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-665 miRNA Mature ID miR-665

miRNA Sequence

 ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

 miR-6727 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

 UCCUGCCACCUCCUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon31

 miR-6747 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon32

 miR-6755 directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6755 miRNA Mature ID miR-6755-5p

miRNA Sequence

 UAGGGUAGACACUGACAACGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon33

 miR-6778 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

 UGCCUCCCUGACAUUCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon34

 miR-6807 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

 GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon35

 miR-6832 directly targets SLC30A5 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6832 miRNA Mature ID miR-6832-5p

miRNA Sequence

 AGUAGAGAGGAAAAGUUAGGGUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon36

 miR-6840 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6840 miRNA Mature ID miR-6840-3p

miRNA Sequence

 GCCCAGGACUUUGUGCGGGGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon37

 miR-6841 directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6841 miRNA Mature ID miR-6841-5p

miRNA Sequence

 UAGGGUACUCAGAGCAAGUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon38

 miR-6851 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

 AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

 miR-6880 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6880 miRNA Mature ID miR-6880-5p

miRNA Sequence

 UGGUGGAGGAAGAGGGCAGCUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

 miR-6890 directly targets SLC30A5 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

 CCACUGCCUAUGCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon41

 miR-7158 directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7158 miRNA Mature ID miR-7158-5p

miRNA Sequence

 GGCUCAAUCUCUGGUCCUGCAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon42

 miR-7847 directly targets SLC30A5 [ 5 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7847 miRNA Mature ID miR-7847-3p

miRNA Sequence

 CGUGGAGGACGAGGAGGAGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

 miR-7853 directly targets SLC30A5 [ 6 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7853 miRNA Mature ID miR-7853-5p

miRNA Sequence

 UCAAAUGCAGAUCCUGACUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
6 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
7 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
8 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
9 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
10 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.