Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0273 Transporter Info | ||||
Gene Name | SLC30A4 | ||||
Transporter Name | Zinc transporter 4 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC30A4 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
Location |
3'UTR (cg20049927) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:3.68E-10; Z-score:-2.01E+00 | ||
Methylation in Case |
5.99E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
44 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-1227 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1227 | miRNA Mature ID | miR-1227-3p | ||
miRNA Sequence |
CGUGCCACCCUUUUCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-1262 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1262 | miRNA Mature ID | miR-1262 | ||
miRNA Sequence |
AUGGGUGAAUUUGUAGAAGGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-1277 directly targets SLC30A4 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1277 | miRNA Mature ID | miR-1277-5p | ||
miRNA Sequence |
AAAUAUAUAUAUAUAUGUACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon4 |
miR-1299 directly targets SLC30A4 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1299 | miRNA Mature ID | miR-1299 | ||
miRNA Sequence |
UUCUGGAAUUCUGUGUGAGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
miR-1305 directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1305 | miRNA Mature ID | miR-1305 | ||
miRNA Sequence |
UUUUCAACUCUAAUGGGAGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-186 directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-5p | ||
miRNA Sequence |
CAAAGAAUUCUCCUUUUGGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon7 |
miR-190a directly targets SLC30A4 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-190a | miRNA Mature ID | miR-190a-3p | ||
miRNA Sequence |
CUAUAUAUCAAACAUAUUCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon8 |
miR-302a directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302a | miRNA Mature ID | miR-302a-5p | ||
miRNA Sequence |
ACUUAAACGUGGAUGUACUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon9 |
miR-3120 directly targets SLC30A4 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3120 | miRNA Mature ID | miR-3120-3p | ||
miRNA Sequence |
CACAGCAAGUGUAGACAGGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon10 |
miR-378j directly targets SLC30A4 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-378j | miRNA Mature ID | miR-378j | ||
miRNA Sequence |
ACUGGAUUUGGAGCCAGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon11 |
miR-4252 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4252 | miRNA Mature ID | miR-4252 | ||
miRNA Sequence |
GGCCACUGAGUCAGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon12 |
miR-4645 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4645 | miRNA Mature ID | miR-4645-3p | ||
miRNA Sequence |
AGACAGUAGUUCUUGCCUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon13 |
miR-4668 directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4668 | miRNA Mature ID | miR-4668-5p | ||
miRNA Sequence |
AGGGAAAAAAAAAAGGAUUUGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon14 |
miR-4684 directly targets SLC30A4 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4684 | miRNA Mature ID | miR-4684-3p | ||
miRNA Sequence |
UGUUGCAAGUCGGUGGAGACGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon15 |
miR-4701 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-3p | ||
miRNA Sequence |
AUGGGUGAUGGGUGUGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon16 |
miR-4782 directly targets SLC30A4 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4782 | miRNA Mature ID | miR-4782-5p | ||
miRNA Sequence |
UUCUGGAUAUGAAGACAAUCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon17 |
miR-4789 directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4789 | miRNA Mature ID | miR-4789-3p | ||
miRNA Sequence |
CACACAUAGCAGGUGUAUAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon18 |
miR-4793 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4793 | miRNA Mature ID | miR-4793-3p | ||
miRNA Sequence |
UCUGCACUGUGAGUUGGCUGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon19 |
miR-497 directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-497 | miRNA Mature ID | miR-497-3p | ||
miRNA Sequence |
CAAACCACACUGUGGUGUUAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon20 |
miR-5011 directly targets SLC30A4 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5011 | miRNA Mature ID | miR-5011-5p | ||
miRNA Sequence |
UAUAUAUACAGCCAUGCACUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon21 |
miR-508 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-508 | miRNA Mature ID | miR-508-5p | ||
miRNA Sequence |
UACUCCAGAGGGCGUCACUCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon22 |
miR-518a directly targets SLC30A4 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-518a | miRNA Mature ID | miR-518a-5p | ||
miRNA Sequence |
CUGCAAAGGGAAGCCCUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon23 |
miR-527 directly targets SLC30A4 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-527 | miRNA Mature ID | miR-527 | ||
miRNA Sequence |
CUGCAAAGGGAAGCCCUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon24 |
miR-542 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-542 | miRNA Mature ID | miR-542-3p | ||
miRNA Sequence |
UGUGACAGAUUGAUAACUGAAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon25 |
miR-548aa directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548aa | miRNA Mature ID | miR-548aa | ||
miRNA Sequence |
AAAAACCACAAUUACUUUUGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon26 |
miR-548ap directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548ap | miRNA Mature ID | miR-548ap-3p | ||
miRNA Sequence |
AAAAACCACAAUUACUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon27 |
miR-548aw directly targets SLC30A4 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548aw | miRNA Mature ID | miR-548aw | ||
miRNA Sequence |
GUGCAAAAGUCAUCACGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon28 |
miR-548t directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548t | miRNA Mature ID | miR-548t-3p | ||
miRNA Sequence |
AAAAACCACAAUUACUUUUGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon29 |
miR-5706 directly targets SLC30A4 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5706 | miRNA Mature ID | miR-5706 | ||
miRNA Sequence |
UUCUGGAUAACAUGCUGAAGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon30 |
miR-6128 directly targets SLC30A4 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6128 | miRNA Mature ID | miR-6128 | ||
miRNA Sequence |
ACUGGAAUUGGAGUCAAAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon31 |
miR-627 directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-627 | miRNA Mature ID | miR-627-3p | ||
miRNA Sequence |
UCUUUUCUUUGAGACUCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon32 |
miR-6512 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6512 | miRNA Mature ID | miR-6512-3p | ||
miRNA Sequence |
UUCCAGCCCUUCUAAUGGUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon33 |
miR-6720 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6720 | miRNA Mature ID | miR-6720-5p | ||
miRNA Sequence |
UUCCAGCCCUGGUAGGCGCCGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon34 |
miR-6736 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6736 | miRNA Mature ID | miR-6736-5p | ||
miRNA Sequence |
CUGGGUGAGGGCAUCUGUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon35 |
miR-6742 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6742 | miRNA Mature ID | miR-6742-3p | ||
miRNA Sequence |
ACCUGGGUUGUCCCCUCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon36 |
miR-6776 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6776 | miRNA Mature ID | miR-6776-5p | ||
miRNA Sequence |
UCUGGGUGCAGUGGGGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon37 |
miR-6839 directly targets SLC30A4 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6839 | miRNA Mature ID | miR-6839-5p | ||
miRNA Sequence |
UCUGGAUUGAAGAGACGACCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon38 |
miR-6889 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6889 | miRNA Mature ID | miR-6889-3p | ||
miRNA Sequence |
UCUGUGCCCCUACUUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon39 |
miR-766 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-766 | miRNA Mature ID | miR-766-3p | ||
miRNA Sequence |
ACUCCAGCCCCACAGCCUCAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon40 |
miR-7703 directly targets SLC30A4 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7703 | miRNA Mature ID | miR-7703 | ||
miRNA Sequence |
UUGCACUCUGGCCUUCUCCCAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon41 |
miR-8058 directly targets SLC30A4 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8058 | miRNA Mature ID | miR-8058 | ||
miRNA Sequence |
CUGGACUUUGAUCUUGCCAUAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon42 |
miR-8485 directly targets SLC30A4 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8485 | miRNA Mature ID | miR-8485 | ||
miRNA Sequence |
CACACACACACACACACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon43 |
miR-875 directly targets SLC30A4 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-875 | miRNA Mature ID | miR-875-3p | ||
miRNA Sequence |
CCUGGAAACACUGAGGUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon44 |
miR-9 directly targets SLC30A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-9 | miRNA Mature ID | miR-9-5p | ||
miRNA Sequence |
UCUUUGGUUAUCUAGCUGUAUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.