General Information of Drug Transporter (DT)
DT ID DTD0271 Transporter Info
Gene Name SLC30A2
Transporter Name Zinc transporter 2
Gene ID
7780
UniProt ID
Q9BRI3
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-335 directly targets SLC30A2 [ 1 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-4731 directly targets SLC30A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4731 miRNA Mature ID miR-4731-5p

miRNA Sequence

UGCUGGGGGCCACAUGAGUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-5089 directly targets SLC30A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5089 miRNA Mature ID miR-5089-5p

miRNA Sequence

GUGGGAUUUCUGAGUAGCAUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-5589 directly targets SLC30A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5589 miRNA Mature ID miR-5589-5p

miRNA Sequence

GGCUGGGUGCUCUUGUGCAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-619 directly targets SLC30A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-6506 directly targets SLC30A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-6511b directly targets SLC30A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6511b miRNA Mature ID miR-6511b-5p

miRNA Sequence

CUGCAGGCAGAAGUGGGGCUGACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-6807 directly targets SLC30A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-6811 directly targets SLC30A2 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6811 miRNA Mature ID miR-6811-5p

miRNA Sequence

AUGCAGGCCUGUGUACAGCACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

Methylation

  Chordoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC30A2 in chordoma than that in healthy individual

Studied Phenotype

Chordoma [ICD-11:5A61.0]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.004710753; Fold-change:-0.233822442; Z-score:-4.51954971
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC30A2 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.66E-17; Fold-change:-0.48886907; Z-score:-3.060494308
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC30A2 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.82E-19; Fold-change:-0.512642848; Z-score:-2.901886656
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Multilayered rosettes embryonal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC30A2 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.42E-18; Fold-change:-0.537220754; Z-score:-3.368046515
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Squamous cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC30A2 in squamous cell carcinoma than that in adjacent tissue

Studied Phenotype

Squamous cell carcinoma [ICD-11:2B60]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:0.001646861; Fold-change:-0.211872199; Z-score:-2.568696763
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
References
1 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
2 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.