Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0267 Transporter Info
Gene Name SLC2A9
Transporter Name Glucose transporter type 9
Gene ID
56606
UniProt ID
Q9NRM0
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in bladder cancer [ 1 ]

Location

 5'UTR (cg25788793)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.83E+00 Statistic Test p-value:4.40E-11; Z-score:-1.07E+01

Methylation in Case

 1.10E-01 (Median) Methylation in Control 3.10E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in bladder cancer [ 1 ]

Location

 5'UTR (cg26409237)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:9.76E-04; Z-score:-4.61E+00

Methylation in Case

 7.58E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A9 in bladder cancer [ 1 ]

Location

 TSS1500 (cg23642392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.22E+00 Statistic Test p-value:3.78E-10; Z-score:-8.99E+00

Methylation in Case

 2.68E-01 (Median) Methylation in Control 5.95E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A9 in bladder cancer [ 1 ]

Location

 TSS1500 (cg08649013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:1.12E-04; Z-score:-5.80E+00

Methylation in Case

 7.72E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in breast cancer [ 2 ]

Location

 5'UTR (cg25788793)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.49E+00 Statistic Test p-value:1.75E-09; Z-score:-2.00E+00

Methylation in Case

 2.05E-01 (Median) Methylation in Control 3.06E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in breast cancer [ 2 ]

Location

 5'UTR (cg26409237)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:2.85E-03; Z-score:-5.58E-01

Methylation in Case

 7.80E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A9 in breast cancer [ 2 ]

Location

 TSS1500 (cg23642392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.37E+00 Statistic Test p-value:6.85E-11; Z-score:-1.95E+00

Methylation in Case

 4.46E-01 (Median) Methylation in Control 6.11E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A9 in breast cancer [ 2 ]

Location

 TSS1500 (cg08649013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:2.90E-10; Z-score:-1.91E+00

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC2A9 in breast cancer [ 2 ]

Location

 TSS1500 (cg03640465)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:3.44E-02; Z-score:-2.22E-01

Methylation in Case

 7.80E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in colorectal cancer [ 3 ]

Location

 5'UTR (cg25788793)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.36E+00 Statistic Test p-value:6.72E-05; Z-score:-9.15E-01

Methylation in Case

 2.64E-01 (Median) Methylation in Control 3.58E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in colorectal cancer [ 3 ]

Location

 5'UTR (cg26409237)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:7.31E-03; Z-score:-3.23E-01

Methylation in Case

 9.06E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A9 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg23642392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.27E+00 Statistic Test p-value:1.33E-13; Z-score:-3.33E+00

Methylation in Case

 6.38E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A9 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg08649013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:1.66E-05; Z-score:-1.56E+00

Methylation in Case

 8.75E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg26409237)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:2.02E-09; Z-score:-4.63E+00

Methylation in Case

 7.01E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg25788793)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.31E+00 Statistic Test p-value:4.17E-08; Z-score:-1.25E+00

Methylation in Case

 1.84E-01 (Median) Methylation in Control 2.41E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A9 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg08649013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:3.96E-06; Z-score:-1.21E+00

Methylation in Case

 7.90E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A9 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg03640465)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.17E+00 Statistic Test p-value:1.75E-03; Z-score:-5.64E-01

Methylation in Case

 7.17E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC2A9 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg09153713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.50E+00 Statistic Test p-value:7.12E-20; Z-score:-3.09E+00

Methylation in Case

 4.07E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in lung adenocarcinoma [ 5 ]

Location

 5'UTR (cg25788793)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.75E+00 Statistic Test p-value:7.85E-06; Z-score:-3.32E+00

Methylation in Case

 3.33E-01 (Median) Methylation in Control 5.83E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in lung adenocarcinoma [ 5 ]

Location

 TSS1500 (cg08649013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:1.54E-04; Z-score:-3.23E+00

Methylation in Case

 8.28E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A9 in lung adenocarcinoma [ 5 ]

Location

 TSS1500 (cg23642392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:2.51E-03; Z-score:-1.83E+00

Methylation in Case

 6.24E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in panic disorder [ 6 ]

Location

 5'UTR (cg25788793)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-9.32E-01 Statistic Test p-value:4.08E-02; Z-score:-3.64E-01

Methylation in Case

 -2.29E+00 (Median) Methylation in Control -2.14E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in panic disorder [ 6 ]

Location

 TSS1500 (cg08649013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:1.93E-02; Z-score:6.50E-01

Methylation in Case

 2.74E+00 (Median) Methylation in Control 2.51E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in papillary thyroid cancer [ 7 ]

Location

 5'UTR (cg25788793)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.63E+00 Statistic Test p-value:8.24E-19; Z-score:-2.64E+00

Methylation in Case

 3.71E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg23642392)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:6.48E-03; Z-score:-4.91E-01

Methylation in Case

 7.04E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in prostate cancer [ 8 ]

Location

 5'UTR (cg22266009)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:2.59E-02; Z-score:2.17E+00

Methylation in Case

 8.77E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in prostate cancer [ 8 ]

Location

 Body (cg15275965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.16E+00 Statistic Test p-value:2.18E-02; Z-score:2.47E+00

Methylation in Case

 9.01E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A9 in prostate cancer [ 8 ]

Location

 Body (cg22792910)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.39E+00 Statistic Test p-value:3.17E-02; Z-score:-3.81E+00

Methylation in Case

 2.66E-01 (Median) Methylation in Control 3.70E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC2A9 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg02739870)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:3.64E-04; Z-score:-3.79E-01

Methylation in Case

 4.31E-01 (Median) Methylation in Control 4.48E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC2A9 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg26281559)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:2.57E-02; Z-score:-4.21E-01

Methylation in Case

 5.66E-02 (Median) Methylation in Control 6.08E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC2A9 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg14028489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:3.12E-02; Z-score:4.07E-01

Methylation in Case

 2.10E-02 (Median) Methylation in Control 1.91E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC2A9 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg08181642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:1.47E-02; Z-score:-4.77E-01

Methylation in Case

 6.74E-01 (Median) Methylation in Control 6.99E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer metastasis

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Significant hypomethylation of SLC2A9 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

 Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value:0.023557744; Fold-change:-0.301157442; Z-score:-85.4201829
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-1224 directly targets SLC2A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

 CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-1260a directly targets SLC2A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1260a miRNA Mature ID miR-1260a

miRNA Sequence

 AUCCCACCUCUGCCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-1260b directly targets SLC2A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

 AUCCCACCACUGCCACCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-1264 directly targets SLC2A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1264 miRNA Mature ID miR-1264

miRNA Sequence

 CAAGUCUUAUUUGAGCACCUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

 miR-188 directly targets SLC2A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-188 miRNA Mature ID miR-188-3p

miRNA Sequence

 CUCCCACAUGCAGGGUUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-3156 directly targets SLC2A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3156 miRNA Mature ID miR-3156-3p

miRNA Sequence

 CUCCCACUUCCAGAUCUUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-33a directly targets SLC2A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-33a miRNA Mature ID miR-33a-3p

miRNA Sequence

 CAAUGUUUCCACAGUGCAUCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-4307 directly targets SLC2A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4307 miRNA Mature ID miR-4307

miRNA Sequence

 AAUGUUUUUUCCUGUUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-4446 directly targets SLC2A9 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4446 miRNA Mature ID miR-4446-5p

miRNA Sequence

 AUUUCCCUGCCAUUCCCUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-4643 directly targets SLC2A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4643 miRNA Mature ID miR-4643

miRNA Sequence

 GACACAUGACCAUAAAUGCUAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

 miR-466 directly targets SLC2A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-466 miRNA Mature ID miR-466

miRNA Sequence

 AUACACAUACACGCAACACACAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

 miR-4778 directly targets SLC2A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4778 miRNA Mature ID miR-4778-3p

miRNA Sequence

 UCUUCUUCCUUUGCAGAGUUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

 miR-4789 directly targets SLC2A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

 CACACAUAGCAGGUGUAUAUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

 miR-5691 directly targets SLC2A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5691 miRNA Mature ID miR-5691

miRNA Sequence

 UUGCUCUGAGCUCCGAGAAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

 miR-6740 directly targets SLC2A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6740 miRNA Mature ID miR-6740-3p

miRNA Sequence

 UGUCUUCUCUCCUCCCAAACAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

 miR-6805 directly targets SLC2A9 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6805 miRNA Mature ID miR-6805-3p

miRNA Sequence

 UUGCUCUGCUCCCCCGCCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
11 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.