Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0264 Transporter Info | ||||
| Gene Name | SLC2A6 | ||||
| Transporter Name | Glucose transporter type 6 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1227 directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1227 | miRNA Mature ID | miR-1227-3p | ||
|
miRNA Sequence |
CGUGCCACCCUUUUCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-129 directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
|
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-208a directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-208a | miRNA Mature ID | miR-208a-5p | ||
|
miRNA Sequence |
GAGCUUUUGGCCCGGGUUAUAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-208b directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-208b | miRNA Mature ID | miR-208b-5p | ||
|
miRNA Sequence |
AAGCUUUUUGCUCGAAUUAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-26b directly targets SLC2A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon6 |
miR-3149 directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3149 | miRNA Mature ID | miR-3149 | ||
|
miRNA Sequence |
UUUGUAUGGAUAUGUGUGUGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-3665 directly targets SLC2A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3665 | miRNA Mature ID | miR-3665 | ||
|
miRNA Sequence |
AGCAGGUGCGGGGCGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
miR-3674 directly targets SLC2A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3674 | miRNA Mature ID | miR-3674 | ||
|
miRNA Sequence |
AUUGUAGAACCUAAGAUUGGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
miR-4464 directly targets SLC2A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4464 | miRNA Mature ID | miR-4464 | ||
|
miRNA Sequence |
AAGGUUUGGAUAGAUGCAAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
miR-4701 directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-5p | ||
|
miRNA Sequence |
UUGGCCACCACACCUACCCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-4715 directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4715 | miRNA Mature ID | miR-4715-3p | ||
|
miRNA Sequence |
GUGCCACCUUAACUGCAGCCAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-4748 directly targets SLC2A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4748 | miRNA Mature ID | miR-4748 | ||
|
miRNA Sequence |
GAGGUUUGGGGAGGAUUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
miR-500b directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-500b | miRNA Mature ID | miR-500b-3p | ||
|
miRNA Sequence |
GCACCCAGGCAAGGAUUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-5087 directly targets SLC2A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5087 | miRNA Mature ID | miR-5087 | ||
|
miRNA Sequence |
GGGUUUGUAGCUUUGCUGGCAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
miR-657 directly targets SLC2A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-657 | miRNA Mature ID | miR-657 | ||
|
miRNA Sequence |
GGCAGGUUCUCACCCUCUCUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
miR-6867 directly targets SLC2A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-5p | ||
|
miRNA Sequence |
UGUGUGUGUAGAGGAAGAAGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-92a directly targets SLC2A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
|
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.